Incidental Mutation 'R4064:Etfdh'
ID316002
Institutional Source Beutler Lab
Gene Symbol Etfdh
Ensembl Gene ENSMUSG00000027809
Gene Nameelectron transferring flavoprotein, dehydrogenase
Synonyms0610010I20Rik
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79603788-79629500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79605791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 435 (E435G)
Ref Sequence ENSEMBL: ENSMUSP00000029386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029382] [ENSMUST00000029386] [ENSMUST00000120992]
Predicted Effect probably benign
Transcript: ENSMUST00000029382
SMART Domains Protein: ENSMUSP00000029382
Gene: ENSMUSG00000027804

DomainStartEndE-ValueType
Pfam:Pro_isomerase 19 183 1.5e-49 PFAM
low complexity region 208 222 N/A INTRINSIC
TPR 223 256 1.78e-1 SMART
TPR 273 306 2.59e-3 SMART
TPR 307 340 2.82e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000029386
AA Change: E435G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029386
Gene: ENSMUSG00000027809
AA Change: E435G

DomainStartEndE-ValueType
Pfam:Thi4 57 123 5.3e-9 PFAM
Pfam:FAD_binding_2 69 120 1.7e-7 PFAM
Pfam:Lycopene_cycl 69 125 5.7e-8 PFAM
Pfam:NAD_binding_8 72 122 9.7e-8 PFAM
Pfam:ETF_QO 511 614 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120992
AA Change: E375G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113888
Gene: ENSMUSG00000027809
AA Change: E375G

DomainStartEndE-ValueType
Pfam:Thi4 1 63 2e-8 PFAM
Pfam:FAD_binding_2 9 59 4.7e-8 PFAM
Pfam:Pyr_redox_2 9 209 1.7e-7 PFAM
Pfam:NAD_binding_9 11 56 2.1e-7 PFAM
Pfam:NAD_binding_8 12 61 2.8e-8 PFAM
Pfam:ETF_QO 402 511 3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195767
Meta Mutation Damage Score 0.4337 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the electron-transfer system in mitochondria and is essential for electron transfer from a number of mitochondrial flavin-containing dehydrogenases to the main respiratory chain. Mutations in this gene are associated with glutaric acidemia. Alternatively spliced transcript variants that encode distinct isoforms have been observed. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Etfdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Etfdh APN 3 79612061 splice site probably benign
IGL02231:Etfdh APN 3 79618393 missense probably damaging 1.00
IGL02414:Etfdh APN 3 79604096 missense probably damaging 0.99
IGL02816:Etfdh APN 3 79622805 missense probably damaging 1.00
PIT4142001:Etfdh UTSW 3 79609867 missense probably damaging 1.00
R0329:Etfdh UTSW 3 79609844 missense probably benign
R0555:Etfdh UTSW 3 79605805 missense probably benign 0.01
R2255:Etfdh UTSW 3 79604042 missense probably benign 0.10
R3040:Etfdh UTSW 3 79604919 missense probably damaging 1.00
R4035:Etfdh UTSW 3 79613711 missense probably benign 0.01
R4693:Etfdh UTSW 3 79605803 missense probably damaging 0.97
R4995:Etfdh UTSW 3 79605788 missense probably benign 0.03
R5079:Etfdh UTSW 3 79618398 missense probably damaging 1.00
R5138:Etfdh UTSW 3 79623573 missense probably benign 0.31
R5756:Etfdh UTSW 3 79613756 missense probably benign
R5762:Etfdh UTSW 3 79615954 missense probably null 1.00
R5824:Etfdh UTSW 3 79609945 missense probably damaging 1.00
R5906:Etfdh UTSW 3 79604115 missense probably damaging 1.00
R6165:Etfdh UTSW 3 79604944 missense probably benign
R6185:Etfdh UTSW 3 79605807 missense probably benign 0.00
R6228:Etfdh UTSW 3 79612029 nonsense probably null
R6993:Etfdh UTSW 3 79612031 missense probably benign 0.43
R7559:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7560:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7562:Etfdh UTSW 3 79623579 missense probably damaging 1.00
R7937:Etfdh UTSW 3 79609816 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGAGGTTCCTAACACTACC -3'
(R):5'- ACTGTGCATAAAGCCCCAG -3'

Sequencing Primer
(F):5'- GTTCCTAACACTACCAAAAAGGGGG -3'
(R):5'- GCATAAAGCCCCAGTGCCAG -3'
Posted On2015-05-15