Incidental Mutation 'R4064:Nhlh2'
ID316003
Institutional Source Beutler Lab
Gene Symbol Nhlh2
Ensembl Gene ENSMUSG00000048540
Gene Namenescient helix loop helix 2
SynonymsHen2, 6230401I09Rik, Nscl-2, NSCL2, bHLHa34
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location102010076-102015492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102012736 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 28 (D28G)
Ref Sequence ENSEMBL: ENSMUSP00000143362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066187] [ENSMUST00000196324] [ENSMUST00000198675]
Predicted Effect probably benign
Transcript: ENSMUST00000066187
AA Change: D28G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064355
Gene: ENSMUSG00000048540
AA Change: D28G

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
HLH 83 135 7.82e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196324
AA Change: D28G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142746
Gene: ENSMUSG00000048540
AA Change: D28G

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
HLH 83 135 7.82e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198675
AA Change: D28G

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143362
Gene: ENSMUSG00000048540
AA Change: D28G

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
HLH 83 135 7.82e-17 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Loss of function results in adult-onset obesity and reproductive defects, including hypogonadism, due to disruption of the hypothalamic-pituitary axis. Mutant male mice are sterile, whereas female mice show variable fertility dependent on the presence orabsence of male mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Nhlh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Nhlh2 APN 3 102013026 missense probably damaging 1.00
ANU74:Nhlh2 UTSW 3 102012654 start codon destroyed probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AAGTCCAGGTTTGCTAGGCC -3'
(R):5'- CTCGATCTTGGAGAGCTTCTTG -3'

Sequencing Primer
(F):5'- AGGTTTGCTAGGCCCTCGC -3'
(R):5'- TTGAAAGCCTCCACTCGGATG -3'
Posted On2015-05-15