Mutagenetix > Incidental Mutations

Incidental Mutation 'R4064:Ago4'

316006

Institutional Source

Beutler Lab

Gene Symbol

Ago4

Ensembl Gene

ENSMUSG00000042500

Gene Name

argonaute RISC catalytic subunit 4

Synonyms

argonaute 4, Eif2c4, 5730550L01Rik

MMRRC Submission

041620-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R4064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126489541-126533472 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 126515862 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000081312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084289]

Predicted Effect

probably benign
Transcript: ENSMUST00000084289

SMART Domains

Protein: ENSMUSP00000081312
Gene: ENSMUSG00000042500

Domain	Start	End	E-Value	Type
Pfam:ArgoN	18	156	3.9e-28	PFAM
DUF1785	165	217	4.22e-24	SMART
PAZ	225	360	1.26e-3	SMART
Pfam:ArgoL2	365	412	1.2e-16	PFAM
Pfam:ArgoMid	421	503	8.6e-35	PFAM
Piwi	509	820	2.9e-130	SMART
Blast:Piwi	827	856	2e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122951

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Argonaute family of proteins which contain PAZ and PIWI domains and play an integral role in RNA interference and short-interfering-RNA-mediated gene silencing. This gene is located on chromosome 1 in a cluster of related family members. [provided by RefSeq, Mar 2017]
PHENOTYPE: Male mice homozygous for a null mutation display oligozoospermia, decreased testis weight, premature entry into meiosis and disruption of sex body formation. However both males and females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	G	19: 43,804,993	Y361*	probably null	Het
Afmid	A	G	11: 117,836,528	T293A	probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Axl	C	A	7: 25,764,020	V602L	probably benign	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Duoxa2	G	T	2: 122,300,577	S73I	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Etfdh	T	C	3: 79,605,791	E435G	possibly damaging	Het
Fbxo15	C	T	18: 84,959,118	R52C	probably damaging	Het
Fosb	G	T	7: 19,305,192	C186*	probably null	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Mphosph9	A	T	5: 124,290,917	F683I	probably damaging	Het
Mrps24	G	A	11: 5,704,676	R93*	probably null	Het
Nhlh2	A	G	3: 102,012,736	D28G	probably benign	Het
Olfr1	A	T	11: 73,395,522	S167T	probably benign	Het
Olfr1141	A	G	2: 87,753,789	F68S	probably damaging	Het
Otogl	A	T	10: 107,790,649	D1451E	probably benign	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Parp4	A	G	14: 56,624,140	S977G	probably benign	Het
Psmb7	T	C	2: 38,640,176	T98A	probably damaging	Het
Pus10	A	G	11: 23,728,983	K485R	probably damaging	Het
Rab11fip3	T	C	17: 26,024,394	D588G	probably damaging	Het
Rgl2	T	A	17: 33,937,108	D723E	possibly damaging	Het
Rp1	A	T	1: 4,345,400	S1830T	probably benign	Het
Rreb1	T	C	13: 37,930,317	S551P	probably benign	Het
Serpinb7	A	T	1: 107,446,036	E127D	probably benign	Het
Sh3pxd2b	G	T	11: 32,422,263	A477S	probably benign	Het
Slc26a9	T	C	1: 131,763,187	Y568H	probably benign	Het
Tarsl2	G	A	7: 65,652,270	A181T	possibly damaging	Het
Tbc1d2b	T	A	9: 90,218,922	K672*	probably null	Het
Tmem59l	T	C	8: 70,485,719	T168A	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Vmn1r9	T	C	6: 57,071,321	F127S	probably damaging	Het
Zfp282	G	A	6: 47,880,094	R87H	probably damaging	Het
Zfp292	A	G	4: 34,810,863	V727A	probably damaging	Het
Zscan22	C	T	7: 12,907,014	T395I	probably damaging	Het

Other mutations in Ago4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00957:Ago4	APN	4	126517133	missense	probably benign	0.01
IGL00965:Ago4	APN	4	126493314	missense	probably benign	0.01
IGL01306:Ago4	APN	4	126515884	splice site	probably null
IGL01943:Ago4	APN	4	126517195	missense	probably damaging	1.00
IGL02079:Ago4	APN	4	126517084	missense	probably damaging	0.99
IGL02117:Ago4	APN	4	126516852	missense	probably benign	0.00
IGL02229:Ago4	APN	4	126511532	missense	probably benign	0.34
IGL02503:Ago4	APN	4	126496805	nonsense	probably null
IGL02504:Ago4	APN	4	126517439	missense	probably benign	0.00
IGL02975:Ago4	APN	4	126512519	critical splice donor site	probably null
BB010:Ago4	UTSW	4	126507018	missense	probably benign	0.22
BB020:Ago4	UTSW	4	126507018	missense	probably benign	0.22
IGL02837:Ago4	UTSW	4	126497300	missense	possibly damaging	0.73
R0129:Ago4	UTSW	4	126517183	missense	possibly damaging	0.85
R0142:Ago4	UTSW	4	126516932	missense	probably benign	0.24
R0480:Ago4	UTSW	4	126526077	missense	probably benign	0.00
R0533:Ago4	UTSW	4	126516860	missense	probably benign	0.00
R1014:Ago4	UTSW	4	126506785	missense	probably damaging	1.00
R1350:Ago4	UTSW	4	126507132	missense	probably benign	0.04
R1547:Ago4	UTSW	4	126511413	missense	probably benign	0.01
R1894:Ago4	UTSW	4	126512600	missense	probably benign	0.11
R1900:Ago4	UTSW	4	126516936	missense	probably benign	0.00
R2510:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R2511:Ago4	UTSW	4	126517071	missense	probably damaging	1.00
R4063:Ago4	UTSW	4	126515862	intron	probably benign
R4120:Ago4	UTSW	4	126496807	missense	probably damaging	1.00
R4916:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4917:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4918:Ago4	UTSW	4	126506842	missense	probably damaging	1.00
R4941:Ago4	UTSW	4	126526054	missense	probably benign	0.00
R5169:Ago4	UTSW	4	126511727	missense	probably benign	0.06
R5262:Ago4	UTSW	4	126496764	missense	possibly damaging	0.66
R5385:Ago4	UTSW	4	126517556	missense	probably benign
R5757:Ago4	UTSW	4	126526084	missense	probably damaging	1.00
R6244:Ago4	UTSW	4	126511487	missense	possibly damaging	0.67
R6256:Ago4	UTSW	4	126520226	missense	probably damaging	1.00
R6389:Ago4	UTSW	4	126507244	missense	probably damaging	1.00
R6545:Ago4	UTSW	4	126512018	missense	probably benign	0.10
R7378:Ago4	UTSW	4	126511464	missense	probably benign
R7804:Ago4	UTSW	4	126512630	missense	probably benign	0.02
R7890:Ago4	UTSW	4	126526076	missense	probably benign	0.00
R7933:Ago4	UTSW	4	126507018	missense	probably benign	0.22
X0062:Ago4	UTSW	4	126515941	missense	probably benign	0.00
X0064:Ago4	UTSW	4	126517482	missense	possibly damaging	0.87
Z1176:Ago4	UTSW	4	126520190	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCCTCTGTTATCAAACGGA -3'
(R):5'- AGAATTCTTTCCAGAGTAATGCACTC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GAGCTCACTCTATAGATCAGGCTG -3'

Posted On

2015-05-15