Mutagenetix > Incidental Mutation

Incidental Mutation 'R4064:Zfp282'

316009

Institutional Source

Beutler Lab

Gene Symbol

Zfp282

Ensembl Gene

ENSMUSG00000025821

Gene Name

zinc finger protein 282

Synonyms

HUB1

MMRRC Submission

041620-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R4064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47877204-47908485 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 47880094 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 87 (R87H)

Ref Sequence

ENSEMBL: ENSMUSP00000053643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061890]

AlphaFold

E9PVC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000061890
AA Change: R87H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: R87H

Domain	Start	End	E-Value	Type
low complexity region	11	20	N/A	INTRINSIC
low complexity region	66	75	N/A	INTRINSIC
Pfam:DUF3669	98	168	1.8e-12	PFAM
KRAB	198	260	1.04e-21	SMART
internal_repeat_1	317	372	1.1e-13	PROSPERO
low complexity region	387	399	N/A	INTRINSIC
low complexity region	403	420	N/A	INTRINSIC
low complexity region	457	499	N/A	INTRINSIC
ZnF_C2H2	514	536	8.94e-3	SMART
ZnF_C2H2	542	564	4.72e-2	SMART
ZnF_C2H2	570	592	1.04e-3	SMART
ZnF_C2H2	598	620	4.24e-4	SMART
ZnF_C2H2	626	648	1.06e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125957

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (44/44)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	G	19: 43,804,993	Y361*	probably null	Het
Afmid	A	G	11: 117,836,528	T293A	probably benign	Het
Ago4	A	T	4: 126,515,862		probably benign	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Axl	C	A	7: 25,764,020	V602L	probably benign	Het
Cdc5l	C	T	17: 45,410,890	A485T	probably benign	Het
Duoxa2	G	T	2: 122,300,577	S73I	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Etfdh	T	C	3: 79,605,791	E435G	possibly damaging	Het
Fbxo15	C	T	18: 84,959,118	R52C	probably damaging	Het
Fosb	G	T	7: 19,305,192	C186*	probably null	Het
Gtpbp2	G	A	17: 46,167,327	R467H	probably damaging	Het
Hnrnpll	T	C	17: 80,032,772	H526R	probably benign	Het
Mphosph9	A	T	5: 124,290,917	F683I	probably damaging	Het
Mrps24	G	A	11: 5,704,676	R93*	probably null	Het
Nhlh2	A	G	3: 102,012,736	D28G	probably benign	Het
Olfr1	A	T	11: 73,395,522	S167T	probably benign	Het
Olfr1141	A	G	2: 87,753,789	F68S	probably damaging	Het
Otogl	A	T	10: 107,790,649	D1451E	probably benign	Het
Otop2	G	A	11: 115,329,375	G347D	probably damaging	Het
Parp4	A	G	14: 56,624,140	S977G	probably benign	Het
Psmb7	T	C	2: 38,640,176	T98A	probably damaging	Het
Pus10	A	G	11: 23,728,983	K485R	probably damaging	Het
Rab11fip3	T	C	17: 26,024,394	D588G	probably damaging	Het
Rgl2	T	A	17: 33,937,108	D723E	possibly damaging	Het
Rp1	A	T	1: 4,345,400	S1830T	probably benign	Het
Rreb1	T	C	13: 37,930,317	S551P	probably benign	Het
Serpinb7	A	T	1: 107,446,036	E127D	probably benign	Het
Sh3pxd2b	G	T	11: 32,422,263	A477S	probably benign	Het
Slc26a9	T	C	1: 131,763,187	Y568H	probably benign	Het
Tarsl2	G	A	7: 65,652,270	A181T	possibly damaging	Het
Tbc1d2b	T	A	9: 90,218,922	K672*	probably null	Het
Tmem59l	T	C	8: 70,485,719	T168A	probably damaging	Het
Tshz2	A	G	2: 169,962,325		probably benign	Het
Vmn1r9	T	C	6: 57,071,321	F127S	probably damaging	Het
Zfp292	A	G	4: 34,810,863	V727A	probably damaging	Het
Zscan22	C	T	7: 12,907,014	T395I	probably damaging	Het

Other mutations in Zfp282

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00732:Zfp282	APN	6	47880390	missense	probably damaging	1.00
IGL00755:Zfp282	APN	6	47880390	missense	probably damaging	1.00
IGL01402:Zfp282	APN	6	47897836	missense	probably damaging	0.99
IGL01404:Zfp282	APN	6	47897836	missense	probably damaging	0.99
IGL01484:Zfp282	APN	6	47890120	missense	possibly damaging	0.76
IGL01560:Zfp282	APN	6	47880277	missense	probably damaging	1.00
IGL02949:Zfp282	APN	6	47897914	missense	probably damaging	1.00
FR4304:Zfp282	UTSW	6	47904797	small insertion	probably benign
FR4589:Zfp282	UTSW	6	47904791	small insertion	probably benign
FR4737:Zfp282	UTSW	6	47904790	small insertion	probably benign
FR4737:Zfp282	UTSW	6	47904799	small insertion	probably benign
FR4976:Zfp282	UTSW	6	47904790	small insertion	probably benign
R0020:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R0020:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R0118:Zfp282	UTSW	6	47892932	missense	probably benign	0.34
R0415:Zfp282	UTSW	6	47897881	missense	probably damaging	0.99
R0415:Zfp282	UTSW	6	47905053	missense	possibly damaging	0.88
R0607:Zfp282	UTSW	6	47880369	missense	probably damaging	1.00
R0710:Zfp282	UTSW	6	47880384	missense	probably damaging	1.00
R0946:Zfp282	UTSW	6	47880009	missense	probably damaging	1.00
R1054:Zfp282	UTSW	6	47904599	missense	probably benign	0.00
R1401:Zfp282	UTSW	6	47890174	nonsense	probably null
R1572:Zfp282	UTSW	6	47892867	missense	probably damaging	1.00
R2016:Zfp282	UTSW	6	47897787	splice site	probably null
R2971:Zfp282	UTSW	6	47897932	splice site	probably null
R4478:Zfp282	UTSW	6	47890696	nonsense	probably null
R4530:Zfp282	UTSW	6	47890633	missense	probably benign	0.00
R4532:Zfp282	UTSW	6	47890633	missense	probably benign	0.00
R5068:Zfp282	UTSW	6	47877703	missense	probably benign	0.01
R5261:Zfp282	UTSW	6	47897890	missense	probably damaging	0.99
R5326:Zfp282	UTSW	6	47905327	missense	probably benign
R5551:Zfp282	UTSW	6	47890645	missense	possibly damaging	0.59
R6046:Zfp282	UTSW	6	47880168	missense	probably damaging	1.00
R6408:Zfp282	UTSW	6	47880385	missense	probably damaging	1.00
R7535:Zfp282	UTSW	6	47904944	missense	probably benign	0.03
R8098:Zfp282	UTSW	6	47890718	missense	probably benign	0.00
R8158:Zfp282	UTSW	6	47890692	missense	possibly damaging	0.61
R8304:Zfp282	UTSW	6	47904788	small deletion	probably benign
R8385:Zfp282	UTSW	6	47905089	missense	possibly damaging	0.88
R8543:Zfp282	UTSW	6	47904627	missense	probably benign	0.40
R8817:Zfp282	UTSW	6	47904826	missense	probably benign	0.00
S24628:Zfp282	UTSW	6	47897881	missense	probably damaging	0.99
S24628:Zfp282	UTSW	6	47905053	missense	possibly damaging	0.88
Z1177:Zfp282	UTSW	6	47890637	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCATTAATGAGCCTAGCCAGAG -3'
(R):5'- GTTACCAAACTCCACAGCTGTC -3'

Sequencing Primer
(F):5'- AGACACTGGGTAGTACTTGACTGC -3'
(R):5'- ACAGCTGTCTTCTCACAGTCAG -3'

Posted On

2015-05-15