Incidental Mutation 'R4064:Zfp282'
ID316009
Institutional Source Beutler Lab
Gene Symbol Zfp282
Ensembl Gene ENSMUSG00000025821
Gene Namezinc finger protein 282
SynonymsHUB1
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47877204-47908485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47880094 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 87 (R87H)
Ref Sequence ENSEMBL: ENSMUSP00000053643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061890]
Predicted Effect probably damaging
Transcript: ENSMUST00000061890
AA Change: R87H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053643
Gene: ENSMUSG00000025821
AA Change: R87H

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Pfam:DUF3669 98 168 1.8e-12 PFAM
KRAB 198 260 1.04e-21 SMART
internal_repeat_1 317 372 1.1e-13 PROSPERO
low complexity region 387 399 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 457 499 N/A INTRINSIC
ZnF_C2H2 514 536 8.94e-3 SMART
ZnF_C2H2 542 564 4.72e-2 SMART
ZnF_C2H2 570 592 1.04e-3 SMART
ZnF_C2H2 598 620 4.24e-4 SMART
ZnF_C2H2 626 648 1.06e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125957
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Zfp282
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL00755:Zfp282 APN 6 47880390 missense probably damaging 1.00
IGL01402:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01404:Zfp282 APN 6 47897836 missense probably damaging 0.99
IGL01484:Zfp282 APN 6 47890120 missense possibly damaging 0.76
IGL01560:Zfp282 APN 6 47880277 missense probably damaging 1.00
IGL02949:Zfp282 APN 6 47897914 missense probably damaging 1.00
FR4304:Zfp282 UTSW 6 47904797 small insertion probably benign
FR4589:Zfp282 UTSW 6 47904791 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904790 small insertion probably benign
FR4737:Zfp282 UTSW 6 47904799 small insertion probably benign
FR4976:Zfp282 UTSW 6 47904790 small insertion probably benign
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0020:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R0118:Zfp282 UTSW 6 47892932 missense probably benign 0.34
R0415:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
R0415:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
R0607:Zfp282 UTSW 6 47880369 missense probably damaging 1.00
R0710:Zfp282 UTSW 6 47880384 missense probably damaging 1.00
R0946:Zfp282 UTSW 6 47880009 missense probably damaging 1.00
R1054:Zfp282 UTSW 6 47904599 missense probably benign 0.00
R1401:Zfp282 UTSW 6 47890174 nonsense probably null
R1572:Zfp282 UTSW 6 47892867 missense probably damaging 1.00
R2016:Zfp282 UTSW 6 47897787 splice site probably null
R2971:Zfp282 UTSW 6 47897932 splice site probably null
R4478:Zfp282 UTSW 6 47890696 nonsense probably null
R4530:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R4532:Zfp282 UTSW 6 47890633 missense probably benign 0.00
R5068:Zfp282 UTSW 6 47877703 missense probably benign 0.01
R5261:Zfp282 UTSW 6 47897890 missense probably damaging 0.99
R5326:Zfp282 UTSW 6 47905327 missense probably benign
R5551:Zfp282 UTSW 6 47890645 missense possibly damaging 0.59
R6046:Zfp282 UTSW 6 47880168 missense probably damaging 1.00
R6408:Zfp282 UTSW 6 47880385 missense probably damaging 1.00
R7535:Zfp282 UTSW 6 47904944 missense probably benign 0.03
R8098:Zfp282 UTSW 6 47890718 missense probably benign 0.00
R8158:Zfp282 UTSW 6 47890692 missense possibly damaging 0.61
R8304:Zfp282 UTSW 6 47904788 small deletion probably benign
R8385:Zfp282 UTSW 6 47905089 missense possibly damaging 0.88
S24628:Zfp282 UTSW 6 47897881 missense probably damaging 0.99
S24628:Zfp282 UTSW 6 47905053 missense possibly damaging 0.88
Z1177:Zfp282 UTSW 6 47890637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTAATGAGCCTAGCCAGAG -3'
(R):5'- GTTACCAAACTCCACAGCTGTC -3'

Sequencing Primer
(F):5'- AGACACTGGGTAGTACTTGACTGC -3'
(R):5'- ACAGCTGTCTTCTCACAGTCAG -3'
Posted On2015-05-15