Incidental Mutation 'R4064:Fosb'
ID316012
Institutional Source Beutler Lab
Gene Symbol Fosb
Ensembl Gene ENSMUSG00000003545
Gene NameFBJ osteosarcoma oncogene B
Synonyms
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19302696-19310051 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 19305192 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 186 (C186*)
Ref Sequence ENSEMBL: ENSMUSP00000146525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003640] [ENSMUST00000207334] [ENSMUST00000207716] [ENSMUST00000208326] [ENSMUST00000208446] [ENSMUST00000208505]
Predicted Effect probably null
Transcript: ENSMUST00000003640
AA Change: C222*
SMART Domains Protein: ENSMUSP00000003640
Gene: ENSMUSG00000003545
AA Change: C222*

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
BRLZ 153 217 5.58e-13 SMART
low complexity region 255 265 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181066
Predicted Effect probably null
Transcript: ENSMUST00000207334
AA Change: C186*
Predicted Effect probably null
Transcript: ENSMUST00000207716
AA Change: C147*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208230
Predicted Effect probably null
Transcript: ENSMUST00000208326
AA Change: C183*
Predicted Effect probably null
Transcript: ENSMUST00000208446
AA Change: C222*
Predicted Effect probably null
Transcript: ENSMUST00000208505
AA Change: C186*
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show impaired nurturing behavior, altered behavioral tolerance to repeated motor seizures, reduced NMDA-mediated synaptic currents, and altered paradoxical sleep. Aging mice homozygous for another null allele may exhibit occasional tonic-clonic or generalized seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Fosb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fosb APN 7 19307114 splice site probably null
R0183:Fosb UTSW 7 19307385 missense probably damaging 0.99
R0374:Fosb UTSW 7 19307150 missense probably damaging 0.99
R0555:Fosb UTSW 7 19307213 missense possibly damaging 0.84
R2329:Fosb UTSW 7 19307185 missense probably benign
R3498:Fosb UTSW 7 19306632 missense probably damaging 1.00
R4790:Fosb UTSW 7 19309388 missense probably damaging 1.00
R6327:Fosb UTSW 7 19307227 missense probably benign
R6605:Fosb UTSW 7 19309358 missense probably damaging 1.00
R7282:Fosb UTSW 7 19305188 missense possibly damaging 0.62
R7444:Fosb UTSW 7 19307274 missense possibly damaging 0.86
R7764:Fosb UTSW 7 19305046 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTACGAAGGGCTAACAACG -3'
(R):5'- TACTCTGTGTGGTCGCTGAC -3'

Sequencing Primer
(F):5'- CCGAGGACTTGAACTTCACTGTG -3'
(R):5'- GACCAGCAATTCTCCTTTCTCTG -3'
Posted On2015-05-15