Incidental Mutation 'R4064:Axl'
ID316013
Institutional Source Beutler Lab
Gene Symbol Axl
Ensembl Gene ENSMUSG00000002602
Gene NameAXL receptor tyrosine kinase
SynonymsTyro7, Ufo, Ark
MMRRC Submission 041620-MU
Accession Numbers

Genbank: NM_009465; MGI: 1347244

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25757273-25788705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25764020 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 602 (V602L)
Ref Sequence ENSEMBL: ENSMUSP00000083110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002677] [ENSMUST00000085948]
Predicted Effect probably benign
Transcript: ENSMUST00000002677
AA Change: V611L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000002677
Gene: ENSMUSG00000002602
AA Change: V611L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 444 466 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
TyrKc 530 797 1.91e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085948
AA Change: V602L

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000083110
Gene: ENSMUSG00000002602
AA Change: V602L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 35 124 5.53e-6 SMART
IG 139 218 9.06e-2 SMART
FN3 219 312 9.25e-6 SMART
FN3 328 409 2.18e-2 SMART
transmembrane domain 435 457 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
TyrKc 521 788 1.91e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124442
Predicted Effect probably benign
Transcript: ENSMUST00000132038
SMART Domains Protein: ENSMUSP00000114907
Gene: ENSMUSG00000002602

DomainStartEndE-ValueType
Blast:FN3 2 42 8e-20 BLAST
SCOP:d1gh7a2 2 61 4e-7 SMART
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
Pfam:Pkinase_Tyr 154 188 4.1e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137211
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Tyro3-Axl-Mer (TAM) receptor tyrosine kinase subfamily. The encoded protein possesses an extracellular domain which is composed of two immunoglobulin-like motifs at the N-terminal, followed by two fibronectin type-III motifs. It transduces signals from the extracellular matrix into the cytoplasm by binding to the vitamin K-dependent protein growth arrest-specific 6 (Gas6). This gene may be involved in several cellular functions including growth, migration, aggregation and anti-inflammation in multiple cell types. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant mice are phenotypically normal, however in conjunction with mutations in other related receptor tyrosine kinases, mutations of this gene results in fertility defects, autoimmunity abnormalities, and aberrant apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Axl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Axl APN 7 25785899 missense probably benign 0.16
IGL00428:Axl APN 7 25760872 missense probably damaging 1.00
IGL00725:Axl APN 7 25764483 missense probably damaging 0.97
IGL01348:Axl APN 7 25763309 missense probably damaging 1.00
IGL01350:Axl APN 7 25758750 missense probably damaging 1.00
IGL01357:Axl APN 7 25774169 missense probably benign 0.00
IGL02314:Axl APN 7 25786920 missense possibly damaging 0.50
IGL02321:Axl APN 7 25758769 missense probably damaging 1.00
IGL02839:Axl APN 7 25766791 critical splice donor site probably null
IGL02878:Axl APN 7 25758877 missense probably damaging 0.99
R0125:Axl UTSW 7 25786943 missense probably benign 0.00
R0529:Axl UTSW 7 25787287 splice site probably benign
R0539:Axl UTSW 7 25778717 unclassified probably benign
R0614:Axl UTSW 7 25774163 missense probably benign 0.18
R0747:Axl UTSW 7 25764059 missense possibly damaging 0.95
R1599:Axl UTSW 7 25763969 missense probably damaging 0.99
R1727:Axl UTSW 7 25760766 missense possibly damaging 0.68
R1880:Axl UTSW 7 25774548 missense probably damaging 1.00
R2206:Axl UTSW 7 25770636 missense probably damaging 1.00
R2513:Axl UTSW 7 25787516 missense probably benign
R2877:Axl UTSW 7 25766524 missense probably damaging 0.96
R3802:Axl UTSW 7 25788477 start codon destroyed probably null 0.98
R3915:Axl UTSW 7 25760744 splice site probably benign
R4072:Axl UTSW 7 25763911 unclassified probably benign
R4073:Axl UTSW 7 25763911 unclassified probably benign
R4074:Axl UTSW 7 25763911 unclassified probably benign
R4378:Axl UTSW 7 25758837 missense probably benign 0.06
R5039:Axl UTSW 7 25785915 missense probably damaging 1.00
R5224:Axl UTSW 7 25786944 missense probably benign 0.00
R5328:Axl UTSW 7 25773411 missense probably damaging 1.00
R5519:Axl UTSW 7 25778662 missense possibly damaging 0.93
R5885:Axl UTSW 7 25766852 missense probably damaging 1.00
R6367:Axl UTSW 7 25787433 missense probably damaging 1.00
R6447:Axl UTSW 7 25770283 missense probably damaging 0.96
R6931:Axl UTSW 7 25761433 missense probably damaging 1.00
R7172:Axl UTSW 7 25786974 missense probably benign 0.33
R7355:Axl UTSW 7 25774106 missense probably benign 0.22
R7410:Axl UTSW 7 25758783 missense probably benign 0.06
R8274:Axl UTSW 7 25764013 missense probably damaging 0.99
R8279:Axl UTSW 7 25763954 missense probably benign 0.07
R8281:Axl UTSW 7 25763954 missense probably benign 0.07
R8282:Axl UTSW 7 25763954 missense probably benign 0.07
R8283:Axl UTSW 7 25763954 missense probably benign 0.07
X0027:Axl UTSW 7 25770268 missense probably damaging 1.00
Z1177:Axl UTSW 7 25761526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCACCCCTGCAATACAG -3'
(R):5'- ATGGCCTCTCCGAAGTTTC -3'

Sequencing Primer
(F):5'- TGCAATACAGGCCCCTCGAG -3'
(R):5'- CATCTACCTCCCAAACAATGTGGAG -3'
Posted On2015-05-15