Incidental Mutation 'R4064:Tarsl2'
ID316016
Institutional Source Beutler Lab
Gene Symbol Tarsl2
Ensembl Gene ENSMUSG00000030515
Gene Namethreonyl-tRNA synthetase-like 2
SynonymsA530046H20Rik
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65644898-65692091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65652270 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 181 (A181T)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032728
AA Change: A181T

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: A181T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Meta Mutation Damage Score 0.8397 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Tarsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tarsl2 APN 7 65652259 critical splice acceptor site probably null
IGL00470:Tarsl2 APN 7 65688908 missense probably benign 0.03
IGL00594:Tarsl2 APN 7 65676132 critical splice donor site probably null
IGL01352:Tarsl2 APN 7 65658910 missense possibly damaging 0.80
IGL01519:Tarsl2 APN 7 65663886 missense probably damaging 1.00
IGL01726:Tarsl2 APN 7 65682818 missense possibly damaging 0.46
IGL02370:Tarsl2 APN 7 65661165 missense probably benign 0.17
IGL02729:Tarsl2 APN 7 65682819 missense probably damaging 0.97
IGL03234:Tarsl2 APN 7 65652278 missense probably benign 0.06
gary UTSW 7 65688952 critical splice donor site probably null
smart_money UTSW 7 65678142 missense probably damaging 1.00
R0127:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R0153:Tarsl2 UTSW 7 65684081 missense probably damaging 1.00
R0605:Tarsl2 UTSW 7 65678071 missense probably damaging 1.00
R1070:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1450:Tarsl2 UTSW 7 65647496 missense probably benign 0.01
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R1467:Tarsl2 UTSW 7 65655696 missense probably damaging 1.00
R2142:Tarsl2 UTSW 7 65658897 missense probably benign
R2143:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2144:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2145:Tarsl2 UTSW 7 65655791 missense possibly damaging 0.57
R2208:Tarsl2 UTSW 7 65682848 missense probably damaging 1.00
R3713:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3715:Tarsl2 UTSW 7 65688952 critical splice donor site probably null
R3914:Tarsl2 UTSW 7 65683808 missense probably benign 0.05
R3929:Tarsl2 UTSW 7 65684043 splice site probably null
R4008:Tarsl2 UTSW 7 65678128 missense probably damaging 1.00
R4367:Tarsl2 UTSW 7 65682819 missense probably damaging 0.97
R4652:Tarsl2 UTSW 7 65689969 missense probably damaging 1.00
R4825:Tarsl2 UTSW 7 65647554 missense probably benign 0.38
R4901:Tarsl2 UTSW 7 65691294 missense probably benign 0.05
R4999:Tarsl2 UTSW 7 65658935 missense probably damaging 0.99
R5423:Tarsl2 UTSW 7 65683819 missense probably benign 0.00
R5756:Tarsl2 UTSW 7 65675976 missense probably benign 0.22
R5772:Tarsl2 UTSW 7 65684125 missense probably damaging 1.00
R6160:Tarsl2 UTSW 7 65682779 missense probably benign 0.32
R6230:Tarsl2 UTSW 7 65686436 splice site probably null
R6424:Tarsl2 UTSW 7 65655739 missense probably damaging 1.00
R6615:Tarsl2 UTSW 7 65678142 missense probably damaging 1.00
R6792:Tarsl2 UTSW 7 65662303 missense probably damaging 1.00
R7350:Tarsl2 UTSW 7 65658924 missense probably damaging 1.00
R7549:Tarsl2 UTSW 7 65647593 missense probably damaging 0.96
R7592:Tarsl2 UTSW 7 65658871 missense probably benign 0.01
R7634:Tarsl2 UTSW 7 65676012 missense probably damaging 0.99
R7710:Tarsl2 UTSW 7 65664969 missense probably benign 0.19
R7808:Tarsl2 UTSW 7 65652261 missense probably benign 0.01
R7875:Tarsl2 UTSW 7 65678151 missense probably benign 0.05
R8254:Tarsl2 UTSW 7 65676061 missense probably benign
Z1177:Tarsl2 UTSW 7 65652264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTACTTCTAGAACGAAGGGGTAAG -3'
(R):5'- ATCACCCTTGATTCCAATGCATG -3'

Sequencing Primer
(F):5'- GAACGAAGGGGTAAGATTTATATGAG -3'
(R):5'- CAATGCATGGTACTTCCCATAATTC -3'
Posted On2015-05-15