Incidental Mutation 'R4064:Tmem59l'
ID316018
Institutional Source Beutler Lab
Gene Symbol Tmem59l
Ensembl Gene ENSMUSG00000035964
Gene Nametransmembrane protein 59-like
Synonyms
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70483867-70487358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70485719 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 168 (T168A)
Ref Sequence ENSEMBL: ENSMUSP00000043659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045286]
Predicted Effect probably damaging
Transcript: ENSMUST00000045286
AA Change: T168A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043659
Gene: ENSMUSG00000035964
AA Change: T168A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 33 41 N/A INTRINSIC
low complexity region 44 60 N/A INTRINSIC
Pfam:BSMAP 72 278 1e-67 PFAM
low complexity region 311 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211264
Meta Mutation Damage Score 0.5119 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted type-I membrane glycoprotein. The encoded protein may play a role in functioning of the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Tmem59l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Tmem59l APN 8 70485665 splice site probably benign
IGL01479:Tmem59l APN 8 70486098 missense probably benign 0.00
IGL01783:Tmem59l APN 8 70487224 missense probably damaging 1.00
IGL01998:Tmem59l APN 8 70484781 missense probably benign 0.16
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0973:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R0974:Tmem59l UTSW 8 70486060 missense possibly damaging 0.93
R1201:Tmem59l UTSW 8 70484387 nonsense probably null
R1540:Tmem59l UTSW 8 70485154 missense probably benign 0.05
R1775:Tmem59l UTSW 8 70486253 missense probably damaging 1.00
R2217:Tmem59l UTSW 8 70487301 missense unknown
R2238:Tmem59l UTSW 8 70485122 missense probably damaging 0.99
R2313:Tmem59l UTSW 8 70487301 missense unknown
R2315:Tmem59l UTSW 8 70487301 missense unknown
R2969:Tmem59l UTSW 8 70487301 missense unknown
R2970:Tmem59l UTSW 8 70487301 missense unknown
R3011:Tmem59l UTSW 8 70486237 missense probably damaging 1.00
R3725:Tmem59l UTSW 8 70487301 missense unknown
R3726:Tmem59l UTSW 8 70487301 missense unknown
R3774:Tmem59l UTSW 8 70487301 missense unknown
R3775:Tmem59l UTSW 8 70487301 missense unknown
R3826:Tmem59l UTSW 8 70487301 missense unknown
R3827:Tmem59l UTSW 8 70487301 missense unknown
R3828:Tmem59l UTSW 8 70487301 missense unknown
R3829:Tmem59l UTSW 8 70487301 missense unknown
R3851:Tmem59l UTSW 8 70487301 missense unknown
R3943:Tmem59l UTSW 8 70487301 missense unknown
R3944:Tmem59l UTSW 8 70487301 missense unknown
R4409:Tmem59l UTSW 8 70487301 missense unknown
R4410:Tmem59l UTSW 8 70487301 missense unknown
R4422:Tmem59l UTSW 8 70486099 missense probably damaging 0.98
R4470:Tmem59l UTSW 8 70487301 missense unknown
R4471:Tmem59l UTSW 8 70487301 missense unknown
R4767:Tmem59l UTSW 8 70486098 missense probably benign 0.00
R5321:Tmem59l UTSW 8 70487215 missense probably damaging 1.00
R6130:Tmem59l UTSW 8 70484605 missense probably damaging 1.00
R6527:Tmem59l UTSW 8 70486125 missense probably damaging 1.00
R6603:Tmem59l UTSW 8 70486356 missense probably benign 0.31
R6750:Tmem59l UTSW 8 70486372 missense probably benign 0.34
R7542:Tmem59l UTSW 8 70485164 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CTTTTCAGGTAAAGCCCCAAACAG -3'
(R):5'- TGTCTAAATCAGCACAGCCCAG -3'

Sequencing Primer
(F):5'- AGGCCGCATGAACTGAGTTC -3'
(R):5'- GTCTAAATCAGCACAGCCCAGTTTTC -3'
Posted On2015-05-15