Incidental Mutation 'R4064:Otop2'
ID316026
Institutional Source Beutler Lab
Gene Symbol Otop2
Ensembl Gene ENSMUSG00000050201
Gene Nameotopetrin 2
Synonyms
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115307163-115332303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115329375 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 347 (G347D)
Ref Sequence ENSEMBL: ENSMUSP00000102154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055490] [ENSMUST00000106544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055490
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062109
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 225 1e-18 PFAM
Pfam:Otopetrin 214 451 5.5e-20 PFAM
Pfam:Otopetrin 479 550 8.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106544
AA Change: G347D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102154
Gene: ENSMUSG00000050201
AA Change: G347D

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 62 81 N/A INTRINSIC
Pfam:Otopetrin 102 450 7.9e-54 PFAM
Pfam:Otopetrin 476 550 2e-16 PFAM
Meta Mutation Damage Score 0.8486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Otop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Otop2 APN 11 115331909 missense probably damaging 1.00
IGL01832:Otop2 APN 11 115326943 missense probably benign
IGL02114:Otop2 APN 11 115326980 missense possibly damaging 0.64
IGL02432:Otop2 APN 11 115329162 missense probably damaging 0.99
IGL02453:Otop2 APN 11 115324629 nonsense probably null
IGL02986:Otop2 APN 11 115329567 missense probably benign 0.11
IGL03225:Otop2 APN 11 115329807 missense probably damaging 1.00
R0402:Otop2 UTSW 11 115326408 splice site probably benign
R0553:Otop2 UTSW 11 115329462 missense probably damaging 0.98
R1209:Otop2 UTSW 11 115324643 missense possibly damaging 0.70
R1497:Otop2 UTSW 11 115329849 splice site probably null
R1765:Otop2 UTSW 11 115324678 missense probably benign 0.04
R1822:Otop2 UTSW 11 115324628 missense probably benign 0.41
R1926:Otop2 UTSW 11 115326955 missense probably benign 0.00
R2151:Otop2 UTSW 11 115329411 missense possibly damaging 0.90
R2192:Otop2 UTSW 11 115326931 missense possibly damaging 0.63
R2350:Otop2 UTSW 11 115326850 missense probably damaging 0.97
R2352:Otop2 UTSW 11 115329101 missense probably damaging 1.00
R2915:Otop2 UTSW 11 115329146 missense probably benign 0.07
R3614:Otop2 UTSW 11 115329146 missense probably benign 0.07
R4060:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4061:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4062:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4063:Otop2 UTSW 11 115329375 missense probably damaging 1.00
R4184:Otop2 UTSW 11 115329845 missense probably benign 0.05
R4844:Otop2 UTSW 11 115323375 splice site probably null
R5681:Otop2 UTSW 11 115326859 missense probably damaging 1.00
R5713:Otop2 UTSW 11 115329044 missense probably damaging 0.98
R6738:Otop2 UTSW 11 115329492 missense probably damaging 1.00
R6975:Otop2 UTSW 11 115329326 missense possibly damaging 0.93
RF013:Otop2 UTSW 11 115323666 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAATGTGGGAAGGCTGCTC -3'
(R):5'- GCGATCATGAGTAGAGCGTG -3'

Sequencing Primer
(F):5'- TCCAGGGTCAGCCTGTTC -3'
(R):5'- TGGGACAGGTTGAGCGC -3'
Posted On2015-05-15