Incidental Mutation 'R4064:Afmid'
ID316027
Institutional Source Beutler Lab
Gene Symbol Afmid
Ensembl Gene ENSMUSG00000017718
Gene Namearylformamidase
Synonyms9030621K19Rik, formylkynureninase, formylase, kynurenine formamidase, Kf
MMRRC Submission 041620-MU
Accession Numbers

Genbank: NM_027827; MGI: 2448704

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117825924-117839908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117836528 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 293 (T293A)
Ref Sequence ENSEMBL: ENSMUSP00000119310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073388] [ENSMUST00000132298] [ENSMUST00000149668]
Predicted Effect probably benign
Transcript: ENSMUST00000073388
SMART Domains Protein: ENSMUSP00000073102
Gene: ENSMUSG00000017718

DomainStartEndE-ValueType
Pfam:COesterase 34 139 1.1e-6 PFAM
Pfam:Abhydrolase_5 88 280 4.1e-12 PFAM
Pfam:Abhydrolase_3 89 283 7.8e-19 PFAM
Pfam:Peptidase_S9 106 296 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131268
Predicted Effect probably benign
Transcript: ENSMUST00000132298
SMART Domains Protein: ENSMUSP00000135368
Gene: ENSMUSG00000093485

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148016
Predicted Effect probably benign
Transcript: ENSMUST00000149668
AA Change: T293A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119310
Gene: ENSMUSG00000017718
AA Change: T293A

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 80 272 9.1e-12 PFAM
Pfam:Abhydrolase_3 81 273 1.7e-17 PFAM
Pfam:Peptidase_S9 101 287 2.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153850
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit polydipsia, polyuria and hyperglycemia. Mice homozygous for a full exon 2 deletion show impaired glucose tolerance due to reduced insulin secretion associated with reduced islet mass. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(12)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Afmid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Afmid APN 11 117836426 missense probably damaging 0.99
IGL02205:Afmid APN 11 117835156 missense probably damaging 1.00
IGL02657:Afmid APN 11 117834822 missense possibly damaging 0.72
2107:Afmid UTSW 11 117835561 missense probably damaging 1.00
R0371:Afmid UTSW 11 117835140 splice site probably benign
R0907:Afmid UTSW 11 117835590 splice site probably benign
R0941:Afmid UTSW 11 117835245 splice site probably benign
R1915:Afmid UTSW 11 117835799 missense possibly damaging 0.96
R1975:Afmid UTSW 11 117836474 missense probably benign 0.07
R2034:Afmid UTSW 11 117835235 missense probably benign 0.07
R5386:Afmid UTSW 11 117828142 missense probably benign
R5815:Afmid UTSW 11 117835704 missense probably benign 0.17
R7075:Afmid UTSW 11 117835705 missense probably benign
R7185:Afmid UTSW 11 117834773 missense possibly damaging 0.66
R8016:Afmid UTSW 11 117835544 missense probably benign 0.00
Z1176:Afmid UTSW 11 117834966 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGAGAGCCACCACTTCAG -3'
(R):5'- AACTGTTTATGGTACTCTCTGTGTC -3'

Sequencing Primer
(F):5'- AGCCGCACTCTCATGCC -3'
(R):5'- TCTGTGTCAGAGCCGTAACAAGTC -3'
Posted On2015-05-15