Incidental Mutation 'R4064:Rreb1'
ID316028
Institutional Source Beutler Lab
Gene Symbol Rreb1
Ensembl Gene ENSMUSG00000039087
Gene Nameras responsive element binding protein 1
Synonyms1110037N09Rik, B930013M22Rik
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location37778400-37952005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37930317 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 551 (S551P)
Ref Sequence ENSEMBL: ENSMUSP00000121211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037232] [ENSMUST00000110237] [ENSMUST00000110238] [ENSMUST00000124373] [ENSMUST00000128570] [ENSMUST00000149745]
Predicted Effect probably benign
Transcript: ENSMUST00000037232
AA Change: S551P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049265
Gene: ENSMUSG00000039087
AA Change: S551P

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110237
AA Change: S551P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105866
Gene: ENSMUSG00000039087
AA Change: S551P

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110238
AA Change: S551P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105867
Gene: ENSMUSG00000039087
AA Change: S551P

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124268
Predicted Effect probably benign
Transcript: ENSMUST00000124373
Predicted Effect probably benign
Transcript: ENSMUST00000128570
AA Change: S551P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115599
Gene: ENSMUSG00000039087
AA Change: S551P

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
ZnF_C2H2 1279 1302 1.01e-1 SMART
low complexity region 1324 1339 N/A INTRINSIC
low complexity region 1370 1403 N/A INTRINSIC
ZnF_C2H2 1454 1476 6.13e-1 SMART
low complexity region 1501 1516 N/A INTRINSIC
low complexity region 1535 1548 N/A INTRINSIC
ZnF_C2H2 1574 1596 2.24e-3 SMART
ZnF_C2H2 1602 1624 4.47e-3 SMART
low complexity region 1636 1651 N/A INTRINSIC
low complexity region 1692 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149745
AA Change: S551P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121211
Gene: ENSMUSG00000039087
AA Change: S551P

DomainStartEndE-ValueType
ZnF_C2H2 66 88 5.14e-3 SMART
ZnF_C2H2 97 119 6.42e-4 SMART
ZnF_C2H2 125 147 3.49e-5 SMART
low complexity region 156 175 N/A INTRINSIC
ZnF_C2H2 206 228 1.01e-1 SMART
ZnF_C2H2 233 256 3.78e-1 SMART
ZnF_C2H2 314 336 2.05e-2 SMART
ZnF_C2H2 641 663 2.71e-2 SMART
ZnF_C2H2 669 691 2.27e-4 SMART
ZnF_C2H2 697 720 5.81e-2 SMART
ZnF_C2H2 751 773 9.44e-2 SMART
ZnF_C2H2 788 811 2.14e0 SMART
low complexity region 916 927 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 995 1003 N/A INTRINSIC
low complexity region 1032 1062 N/A INTRINSIC
low complexity region 1071 1083 N/A INTRINSIC
low complexity region 1119 1146 N/A INTRINSIC
low complexity region 1154 1171 N/A INTRINSIC
ZnF_C2H2 1251 1273 1.5e-4 SMART
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to RAS-responsive elements (RREs) of gene promoters. It has been shown that the calcitonin gene promoter contains an RRE and that the encoded protein binds there and increases expression of calcitonin, which may be involved in Ras/Raf-mediated cell differentiation. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Rreb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Rreb1 APN 13 37916496 missense probably benign 0.09
IGL00336:Rreb1 APN 13 37929646 nonsense probably null
IGL00473:Rreb1 APN 13 37930791 nonsense probably null
IGL01338:Rreb1 APN 13 37931034 missense probably damaging 1.00
IGL01836:Rreb1 APN 13 37931457 missense probably damaging 1.00
IGL02066:Rreb1 APN 13 37931506 missense probably benign 0.16
IGL02661:Rreb1 APN 13 37930802 nonsense probably null
IGL02739:Rreb1 APN 13 37893821 missense probably damaging 1.00
IGL03267:Rreb1 APN 13 37932193 missense probably benign 0.30
IGL03332:Rreb1 APN 13 37930916 missense probably benign 0.42
IGL03403:Rreb1 APN 13 37929574 missense possibly damaging 0.78
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0039:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R0101:Rreb1 UTSW 13 37931542 missense probably benign 0.04
R0265:Rreb1 UTSW 13 37916155 nonsense probably null
R0635:Rreb1 UTSW 13 37941564 missense possibly damaging 0.92
R0939:Rreb1 UTSW 13 37932231 missense probably benign 0.09
R1099:Rreb1 UTSW 13 37948891 missense probably benign 0.16
R1438:Rreb1 UTSW 13 37930605 missense probably benign 0.16
R1457:Rreb1 UTSW 13 37946928 missense possibly damaging 0.52
R1510:Rreb1 UTSW 13 37931884 missense probably benign 0.04
R1672:Rreb1 UTSW 13 37930537 missense probably benign 0.09
R1772:Rreb1 UTSW 13 37930923 missense probably benign 0.09
R2171:Rreb1 UTSW 13 37930846 missense probably benign 0.00
R2371:Rreb1 UTSW 13 37916537 missense probably benign 0.09
R2566:Rreb1 UTSW 13 37929792 missense possibly damaging 0.62
R2571:Rreb1 UTSW 13 37899637 missense probably damaging 1.00
R2862:Rreb1 UTSW 13 37932453 missense probably benign 0.02
R2874:Rreb1 UTSW 13 37916508 missense probably benign 0.09
R2911:Rreb1 UTSW 13 37948920 missense probably benign 0.00
R3722:Rreb1 UTSW 13 37947098 missense probably benign 0.01
R3767:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3770:Rreb1 UTSW 13 37929603 missense possibly damaging 0.95
R3885:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3886:Rreb1 UTSW 13 37898506 splice site probably null
R3887:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3888:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R3889:Rreb1 UTSW 13 37893965 missense probably damaging 1.00
R4134:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4135:Rreb1 UTSW 13 37947123 missense probably damaging 1.00
R4174:Rreb1 UTSW 13 37930150 missense possibly damaging 0.95
R4250:Rreb1 UTSW 13 37893893 missense possibly damaging 0.63
R4287:Rreb1 UTSW 13 37931931 missense probably benign 0.03
R4396:Rreb1 UTSW 13 37930443 nonsense probably null
R4658:Rreb1 UTSW 13 37948801 missense probably damaging 1.00
R4841:Rreb1 UTSW 13 37916526 missense probably benign 0.09
R4856:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R4886:Rreb1 UTSW 13 37931058 missense possibly damaging 0.62
R5092:Rreb1 UTSW 13 37928278 missense probably benign 0.09
R5122:Rreb1 UTSW 13 37930768 missense probably benign 0.02
R5405:Rreb1 UTSW 13 37949111 missense probably damaging 0.99
R5408:Rreb1 UTSW 13 37931344 missense probably benign 0.01
R5446:Rreb1 UTSW 13 37898497 missense possibly damaging 0.78
R5641:Rreb1 UTSW 13 37947421 missense probably benign 0.00
R5859:Rreb1 UTSW 13 37947408 missense probably benign 0.24
R5859:Rreb1 UTSW 13 37947409 missense probably benign 0.06
R6429:Rreb1 UTSW 13 37932129 missense probably benign 0.03
R6678:Rreb1 UTSW 13 37899699 missense probably damaging 1.00
R7130:Rreb1 UTSW 13 37899748 missense probably damaging 1.00
R7186:Rreb1 UTSW 13 37941632 missense probably benign 0.02
R7188:Rreb1 UTSW 13 37916568 missense possibly damaging 0.79
R7387:Rreb1 UTSW 13 37947064 missense unknown
R7453:Rreb1 UTSW 13 37941569 missense probably damaging 0.98
R7492:Rreb1 UTSW 13 37931748 missense probably benign 0.00
R7585:Rreb1 UTSW 13 37893898 missense probably benign 0.07
R7621:Rreb1 UTSW 13 37949066 missense
R7645:Rreb1 UTSW 13 37931034 missense probably damaging 1.00
R7653:Rreb1 UTSW 13 37930386 missense probably benign 0.19
R7670:Rreb1 UTSW 13 37931572 missense probably benign 0.00
R7701:Rreb1 UTSW 13 37930116 missense possibly damaging 0.60
R7708:Rreb1 UTSW 13 37929570 missense probably benign 0.18
R7874:Rreb1 UTSW 13 37947124 missense probably damaging 1.00
R8103:Rreb1 UTSW 13 37941701 missense probably benign 0.16
R8129:Rreb1 UTSW 13 37929799 missense probably benign 0.00
R8239:Rreb1 UTSW 13 37893872 missense probably damaging 1.00
R8324:Rreb1 UTSW 13 37947621 missense probably damaging 1.00
X0024:Rreb1 UTSW 13 37931580 missense probably benign 0.09
X0026:Rreb1 UTSW 13 37931992 missense probably benign 0.17
Z1088:Rreb1 UTSW 13 37948937 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTAAAGATGGCAGCTTCCG -3'
(R):5'- ATCTTCGCCTCCATGTTGAG -3'

Sequencing Primer
(F):5'- GCAGATCAGTCTTCCGCCAC -3'
(R):5'- TCCATGTTGAGGGGCAGCAG -3'
Posted On2015-05-15