Incidental Mutation 'R4064:Rgl2'
ID 316032
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 041620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4064 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34156082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 723 (D723E)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000179418] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: D723E

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: D723E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect unknown
Transcript: ENSMUST00000173284
AA Change: D275E
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: D275E

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Meta Mutation Damage Score 0.4541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,793,432 (GRCm39) Y361* probably null Het
Afmid A G 11: 117,727,354 (GRCm39) T293A probably benign Het
Ago4 A T 4: 126,409,655 (GRCm39) probably benign Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Axl C A 7: 25,463,445 (GRCm39) V602L probably benign Het
Cdc5l C T 17: 45,721,816 (GRCm39) A485T probably benign Het
Duoxa2 G T 2: 122,131,058 (GRCm39) S73I probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Etfdh T C 3: 79,513,098 (GRCm39) E435G possibly damaging Het
Fbxo15 C T 18: 84,977,243 (GRCm39) R52C probably damaging Het
Fosb G T 7: 19,039,117 (GRCm39) C186* probably null Het
Gtpbp2 G A 17: 46,478,253 (GRCm39) R467H probably damaging Het
Hnrnpll T C 17: 80,340,201 (GRCm39) H526R probably benign Het
Mphosph9 A T 5: 124,428,980 (GRCm39) F683I probably damaging Het
Mrps24 G A 11: 5,654,676 (GRCm39) R93* probably null Het
Nhlh2 A G 3: 101,920,052 (GRCm39) D28G probably benign Het
Or1e16 A T 11: 73,286,348 (GRCm39) S167T probably benign Het
Or5w17 A G 2: 87,584,133 (GRCm39) F68S probably damaging Het
Otogl A T 10: 107,626,510 (GRCm39) D1451E probably benign Het
Otop2 G A 11: 115,220,201 (GRCm39) G347D probably damaging Het
Parp4 A G 14: 56,861,597 (GRCm39) S977G probably benign Het
Psmb7 T C 2: 38,530,188 (GRCm39) T98A probably damaging Het
Pus10 A G 11: 23,678,983 (GRCm39) K485R probably damaging Het
Rab11fip3 T C 17: 26,243,368 (GRCm39) D588G probably damaging Het
Rp1 A T 1: 4,415,623 (GRCm39) S1830T probably benign Het
Rreb1 T C 13: 38,114,293 (GRCm39) S551P probably benign Het
Serpinb7 A T 1: 107,373,766 (GRCm39) E127D probably benign Het
Sh3pxd2b G T 11: 32,372,263 (GRCm39) A477S probably benign Het
Slc26a9 T C 1: 131,690,925 (GRCm39) Y568H probably benign Het
Tars3 G A 7: 65,302,018 (GRCm39) A181T possibly damaging Het
Tbc1d2b T A 9: 90,100,975 (GRCm39) K672* probably null Het
Tmem59l T C 8: 70,938,369 (GRCm39) T168A probably damaging Het
Tshz2 A G 2: 169,804,245 (GRCm39) probably benign Het
Vmn1r9 T C 6: 57,048,306 (GRCm39) F127S probably damaging Het
Zfp282 G A 6: 47,857,028 (GRCm39) R87H probably damaging Het
Zfp292 A G 4: 34,810,863 (GRCm39) V727A probably damaging Het
Zscan22 C T 7: 12,640,941 (GRCm39) T395I probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTCCAAGTGTTATTAGTCGTG -3'
(R):5'- TCATCCTCAGAACAGTGCCC -3'

Sequencing Primer
(F):5'- AAACAATCGTGATTCTGCTGTGGC -3'
(R):5'- TGCCCGTGCAATCTTCC -3'
Posted On 2015-05-15