Incidental Mutation 'R4064:Hnrnpll'
ID316035
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Nameheterogeneous nuclear ribonucleoprotein L-like
Synonyms2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission 041620-MU
Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80029487-80062334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80032772 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 526 (H526R)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
Predicted Effect probably benign
Transcript: ENSMUST00000061331
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: H526R

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183516
Predicted Effect probably benign
Transcript: ENSMUST00000184297
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184578
Predicted Effect probably benign
Transcript: ENSMUST00000184635
AA Change: H526R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: H526R

DomainStartEndE-ValueType
low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
Grell UTSW 17 80034105 missense probably damaging 1.00
Lindsley UTSW 17 80049847 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1599:Hnrnpll UTSW 17 80053625 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
R7429:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7430:Hnrnpll UTSW 17 80049847 missense probably damaging 1.00
R7576:Hnrnpll UTSW 17 80044514 missense possibly damaging 0.91
R8001:Hnrnpll UTSW 17 80038723 nonsense probably null
R8010:Hnrnpll UTSW 17 80061956 missense unknown
R8060:Hnrnpll UTSW 17 80034105 missense probably damaging 1.00
R8068:Hnrnpll UTSW 17 80050852 missense possibly damaging 0.80
R8381:Hnrnpll UTSW 17 80030491 missense probably damaging 1.00
Z1177:Hnrnpll UTSW 17 80048610 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGGTAGTGATTGAGCGCAG -3'
(R):5'- CATAGCTTCAAACCAATTTCAGGG -3'

Sequencing Primer
(F):5'- GAGCTTCCACGGCATCAGTTTTG -3'
(R):5'- TCCTCAGAACTTGATGTTAAC -3'
Posted On2015-05-15