Incidental Mutation 'R4064:Fbxo15'
ID316036
Institutional Source Beutler Lab
Gene Symbol Fbxo15
Ensembl Gene ENSMUSG00000034391
Gene NameF-box protein 15
SynonymsFbx15, ecat3
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location84934782-84981472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84959118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 52 (R52C)
Ref Sequence ENSEMBL: ENSMUSP00000152915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037718
AA Change: R97C

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391
AA Change: R97C

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224427
Predicted Effect possibly damaging
Transcript: ENSMUST00000224467
AA Change: R52C

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000225445
AA Change: R52C

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO15, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Both male and female homozygous null mice develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Olfr1141 A G 2: 87,753,789 F68S probably damaging Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Fbxo15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Fbxo15 APN 18 84959100 missense probably damaging 1.00
IGL01375:Fbxo15 APN 18 84958279 missense possibly damaging 0.64
IGL01730:Fbxo15 APN 18 84964174 missense probably benign 0.38
IGL01807:Fbxo15 APN 18 84981381 utr 3 prime probably benign
IGL02220:Fbxo15 APN 18 84964192 critical splice donor site probably null
IGL02255:Fbxo15 APN 18 84964196 splice site probably null
IGL02435:Fbxo15 APN 18 84959226 missense probably damaging 0.97
IGL02546:Fbxo15 APN 18 84962722 critical splice donor site probably null
IGL03099:Fbxo15 APN 18 84981213 missense possibly damaging 0.87
R0346:Fbxo15 UTSW 18 84960221 critical splice donor site probably null
R1606:Fbxo15 UTSW 18 84962620 missense possibly damaging 0.93
R1671:Fbxo15 UTSW 18 84959106 missense possibly damaging 0.73
R2113:Fbxo15 UTSW 18 84959105 missense probably benign 0.00
R3962:Fbxo15 UTSW 18 84959247 missense probably benign 0.02
R5523:Fbxo15 UTSW 18 84960069 missense probably damaging 1.00
R5931:Fbxo15 UTSW 18 84981125 missense probably damaging 0.96
R6235:Fbxo15 UTSW 18 84980904 intron probably benign
R6349:Fbxo15 UTSW 18 84964142 missense probably benign 0.01
R6607:Fbxo15 UTSW 18 84959145 missense possibly damaging 0.88
R7232:Fbxo15 UTSW 18 84962622 missense probably damaging 1.00
R7325:Fbxo15 UTSW 18 84959118 missense probably damaging 0.96
R7519:Fbxo15 UTSW 18 84964234 unclassified probably benign
R7671:Fbxo15 UTSW 18 84964153 missense probably damaging 1.00
R8094:Fbxo15 UTSW 18 84965493 missense probably benign 0.34
R8365:Fbxo15 UTSW 18 84962614 missense probably damaging 1.00
X0022:Fbxo15 UTSW 18 84960119 missense probably benign 0.00
Z1177:Fbxo15 UTSW 18 84958308 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTGTTTGCTTTAAATGAGGAACC -3'
(R):5'- TTCGAAGGAAGGCTTGTGCG -3'

Sequencing Primer
(F):5'- TGCTTTAAATGAGGAACCCACAG -3'
(R):5'- CGGCGTTTGACAGGACTGAG -3'
Posted On2015-05-15