Incidental Mutation 'R4065:B430305J03Rik'
ID 316046
Institutional Source Beutler Lab
Gene Symbol B430305J03Rik
Ensembl Gene ENSMUSG00000053706
Gene Name RIKEN cDNA B430305J03 gene
Synonyms
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R4065 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 61362250-61365951 bp(-) (GRCm38)
Type of Mutation utr 5 prime
DNA Base Change (assembly) A to G at 61364225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049064] [ENSMUST00000066298]
AlphaFold Q8BQQ8
Predicted Effect probably benign
Transcript: ENSMUST00000049064
SMART Domains Protein: ENSMUSP00000038841
Gene: ENSMUSG00000036894

DomainStartEndE-ValueType
RAS 1 167 3.08e-111 SMART
Predicted Effect unknown
Transcript: ENSMUST00000066298
AA Change: L33P
SMART Domains Protein: ENSMUSP00000070175
Gene: ENSMUSG00000053706
AA Change: L33P

DomainStartEndE-ValueType
low complexity region 95 103 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194223
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in B430305J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02451:B430305J03Rik APN 3 61364141 utr 5 prime probably benign
R0400:B430305J03Rik UTSW 3 61364135 utr 5 prime probably benign
R0704:B430305J03Rik UTSW 3 61363993 nonsense probably null
R1133:B430305J03Rik UTSW 3 61364009 nonsense probably null
R1727:B430305J03Rik UTSW 3 61363878 utr 5 prime probably benign
R1735:B430305J03Rik UTSW 3 61363940 utr 5 prime probably benign
R4978:B430305J03Rik UTSW 3 61364019 start gained probably benign
R7073:B430305J03Rik UTSW 3 61364260 missense unknown
R7242:B430305J03Rik UTSW 3 61363835 missense unknown
R7345:B430305J03Rik UTSW 3 61364118 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCGATCCACAAGCCATATTTTG -3'
(R):5'- CTTGGAACTGGGCAGTCTTG -3'

Sequencing Primer
(F):5'- TAGGATGACCCCGCAACTCTTG -3'
(R):5'- CAGTCTTGCTTGTGTGTGC -3'
Posted On 2015-05-15