Incidental Mutation 'R4065:Foxj3'
ID316049
Institutional Source Beutler Lab
Gene Symbol Foxj3
Ensembl Gene ENSMUSG00000032998
Gene Nameforkhead box J3
SynonymsC330039G02Rik, Fhd6
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R4065 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119537004-119629119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119610009 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 183 (I183T)
Ref Sequence ENSEMBL: ENSMUSP00000035746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044564] [ENSMUST00000106310]
Predicted Effect probably benign
Transcript: ENSMUST00000044564
AA Change: I183T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035746
Gene: ENSMUSG00000032998
AA Change: I183T

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 226 239 N/A INTRINSIC
low complexity region 263 274 N/A INTRINSIC
low complexity region 317 346 N/A INTRINSIC
low complexity region 372 434 N/A INTRINSIC
low complexity region 611 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106310
SMART Domains Protein: ENSMUSP00000101917
Gene: ENSMUSG00000032998

DomainStartEndE-ValueType
FH 76 164 6.03e-50 SMART
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
low complexity region 338 400 N/A INTRINSIC
low complexity region 577 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal skeletal muscle fiber type ratio in males as well as defects in muscle regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Foxj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Foxj3 APN 4 119610029 missense probably benign 0.03
IGL01452:Foxj3 APN 4 119621628 missense unknown
IGL02056:Foxj3 APN 4 119585757 missense probably damaging 1.00
IGL02455:Foxj3 APN 4 119620237 missense unknown
IGL02542:Foxj3 APN 4 119620343 missense unknown
IGL02625:Foxj3 APN 4 119624917 missense unknown
IGL03216:Foxj3 APN 4 119609983 intron probably benign
R0087:Foxj3 UTSW 4 119626400 missense unknown
R0488:Foxj3 UTSW 4 119619990 nonsense probably null
R0512:Foxj3 UTSW 4 119585836 splice site probably benign
R1531:Foxj3 UTSW 4 119620201 missense unknown
R1799:Foxj3 UTSW 4 119619351 missense probably benign 0.06
R1883:Foxj3 UTSW 4 119610029 missense probably benign 0.20
R3690:Foxj3 UTSW 4 119616642 splice site probably benign
R3691:Foxj3 UTSW 4 119616642 splice site probably benign
R3838:Foxj3 UTSW 4 119616624 missense possibly damaging 0.49
R4295:Foxj3 UTSW 4 119626297 nonsense probably null
R4576:Foxj3 UTSW 4 119621663 missense unknown
R4750:Foxj3 UTSW 4 119616590 missense probably damaging 0.99
R4782:Foxj3 UTSW 4 119621660 missense unknown
R4799:Foxj3 UTSW 4 119621660 missense unknown
R5305:Foxj3 UTSW 4 119619958 missense possibly damaging 0.73
R5358:Foxj3 UTSW 4 119619399 missense probably damaging 1.00
R5362:Foxj3 UTSW 4 119620143 missense unknown
R5728:Foxj3 UTSW 4 119573762 missense probably damaging 1.00
R5732:Foxj3 UTSW 4 119585811 missense probably damaging 1.00
R6151:Foxj3 UTSW 4 119623271 missense unknown
R6352:Foxj3 UTSW 4 119585778 missense probably damaging 1.00
R6377:Foxj3 UTSW 4 119573748 unclassified probably null
R7034:Foxj3 UTSW 4 119619300 missense probably damaging 0.97
R7672:Foxj3 UTSW 4 119620232 missense unknown
R7912:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
R7993:Foxj3 UTSW 4 119620055 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GATCAGTAGCATGCCAGAACATAG -3'
(R):5'- AGATTCAAGTCTCAAGCTGTCAC -3'

Sequencing Primer
(F):5'- TGCCAGAACATAGTCAGAATGC -3'
(R):5'- CAAGCTGTCACATATAGATTGAGC -3'
Posted On2015-05-15