Incidental Mutation 'R4065:Mvp'
ID 316062
Institutional Source Beutler Lab
Gene Symbol Mvp
Ensembl Gene ENSMUSG00000030681
Gene Name major vault protein
Synonyms LRP, VAULT1, 2310009M24Rik
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4065 (G1)
Quality Score 213
Status Not validated
Chromosome 7
Chromosomal Location 126986860-127014621 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126996317 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000127250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133172] [ENSMUST00000165096]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000133172
SMART Domains Protein: ENSMUSP00000119213
Gene: ENSMUSG00000030681

DomainStartEndE-ValueType
Pfam:Vault 25 64 3.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165096
AA Change: V207A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127250
Gene: ENSMUSG00000030681
AA Change: V207A

DomainStartEndE-ValueType
Pfam:Vault 122 163 5.4e-18 PFAM
Pfam:Vault 175 215 7.7e-16 PFAM
Pfam:Vault 228 271 7.9e-14 PFAM
Pfam:Vault 333 377 2.8e-16 PFAM
Pfam:MVP_shoulder 528 656 5.9e-55 PFAM
low complexity region 707 720 N/A INTRINSIC
low complexity region 733 749 N/A INTRINSIC
low complexity region 751 761 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Targeted disruption of this gene does not induce hypersensitivity to various cytostatic agents. Homozygotes are viable, healthy and phenotypically normal and exhibit unimpaired dendritic cell maturation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Mvp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Mvp APN 7 126989687 missense probably benign 0.01
IGL01503:Mvp APN 7 127001961 splice site probably benign
IGL02043:Mvp APN 7 126993618 missense probably damaging 1.00
IGL03412:Mvp APN 7 126993563 missense probably damaging 1.00
R0148:Mvp UTSW 7 126989865 missense probably damaging 1.00
R0458:Mvp UTSW 7 126998491 missense probably damaging 1.00
R0811:Mvp UTSW 7 126987556 missense probably benign
R0812:Mvp UTSW 7 126987556 missense probably benign
R1625:Mvp UTSW 7 127001673 missense probably damaging 1.00
R1707:Mvp UTSW 7 127001572 missense probably benign
R1711:Mvp UTSW 7 126995735 critical splice donor site probably null
R1776:Mvp UTSW 7 126992761 missense probably benign 0.27
R3814:Mvp UTSW 7 126987629 missense probably benign
R4273:Mvp UTSW 7 126989703 missense probably benign 0.16
R4471:Mvp UTSW 7 127001958 start codon destroyed probably null
R4652:Mvp UTSW 7 126993549 missense probably damaging 1.00
R4693:Mvp UTSW 7 126998328 missense probably damaging 0.98
R4972:Mvp UTSW 7 126989798 missense probably damaging 0.99
R5031:Mvp UTSW 7 126993616 nonsense probably null
R5530:Mvp UTSW 7 126995923 missense probably benign 0.45
R7053:Mvp UTSW 7 126987604 missense possibly damaging 0.90
R7324:Mvp UTSW 7 126993609 missense probably benign
R7580:Mvp UTSW 7 126992311 missense probably damaging 1.00
R8146:Mvp UTSW 7 126986999 missense probably benign 0.15
R9180:Mvp UTSW 7 126992650 missense probably benign 0.04
R9197:Mvp UTSW 7 126989787 missense probably damaging 0.99
R9351:Mvp UTSW 7 126996263 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTACCTACCCTGGAGGATAC -3'
(R):5'- TCTGGCCTCAGAGAAAGCAG -3'

Sequencing Primer
(F):5'- CGGGAGATCTGACCTGATTTCTC -3'
(R):5'- CAGTGGCTTCAAGGACCTTG -3'
Posted On 2015-05-15