Incidental Mutation 'R4065:Olfr541'
ID 316064
Institutional Source Beutler Lab
Gene Symbol Olfr541
Ensembl Gene ENSMUSG00000057997
Gene Name olfactory receptor 541
Synonyms GA_x6K02T2PBJ9-42850324-42851256, MOR253-3
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4065 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140697267-140705606 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140704269 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 6 (L6P)
Ref Sequence ENSEMBL: ENSMUSP00000148238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080681] [ENSMUST00000209857] [ENSMUST00000210357]
AlphaFold Q8VGM0
Predicted Effect probably benign
Transcript: ENSMUST00000080681
AA Change: L6P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079508
Gene: ENSMUSG00000057997
AA Change: L6P

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 2.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 180 5e-8 PFAM
Pfam:7tm_1 43 292 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209857
AA Change: L6P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210357
AA Change: L6P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Olfr541
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Olfr541 APN 7 140704437 missense probably damaging 1.00
IGL01872:Olfr541 APN 7 140704263 missense possibly damaging 0.59
IGL02814:Olfr541 APN 7 140705133 missense probably damaging 1.00
R0690:Olfr541 UTSW 7 140704787 missense possibly damaging 0.88
R1019:Olfr541 UTSW 7 140704494 missense probably damaging 1.00
R1665:Olfr541 UTSW 7 140704794 missense probably damaging 1.00
R1696:Olfr541 UTSW 7 140704496 nonsense probably null
R4517:Olfr541 UTSW 7 140705091 missense probably damaging 1.00
R5549:Olfr541 UTSW 7 140704799 splice site probably null
R6327:Olfr541 UTSW 7 140704703 missense probably damaging 1.00
R7288:Olfr541 UTSW 7 140705029 nonsense probably null
R7307:Olfr541 UTSW 7 140705147 missense probably benign 0.39
R7454:Olfr541 UTSW 7 140704634 missense probably damaging 1.00
R8725:Olfr541 UTSW 7 140704694 missense probably benign
R9404:Olfr541 UTSW 7 140704809 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACAGATGTCCCTCTTTGATTC -3'
(R):5'- TACATGGGACTATGGAGCCCAG -3'

Sequencing Primer
(F):5'- ACAGATGTCCCTCTTTGATTCAAATC -3'
(R):5'- GTGCTGGAGGTGACCAAAGC -3'
Posted On 2015-05-15