Incidental Mutation 'R4065:Ppm1d'
ID 316073
Institutional Source Beutler Lab
Gene Symbol Ppm1d
Ensembl Gene ENSMUSG00000020525
Gene Name protein phosphatase 1D magnesium-dependent, delta isoform
Synonyms Wip1
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4065 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 85311244-85347066 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85345852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 486 (T486A)
Ref Sequence ENSEMBL: ENSMUSP00000020835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020835]
AlphaFold Q9QZ67
Predicted Effect probably benign
Transcript: ENSMUST00000020835
AA Change: T486A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: T486A

DomainStartEndE-ValueType
PP2Cc 1 366 1.4e-76 SMART
PP2C_SIG 78 368 6.09e0 SMART
low complexity region 403 415 N/A INTRINSIC
Blast:PP2Cc 416 476 1e-19 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dhx29 T A 13: 112,964,742 probably null Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Ppm1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:Ppm1d APN 11 85327006 missense probably benign 0.04
IGL02351:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02358:Ppm1d APN 11 85345715 missense probably damaging 0.99
IGL02496:Ppm1d APN 11 85339666 missense possibly damaging 0.51
IGL02667:Ppm1d APN 11 85332285 missense probably damaging 1.00
IGL02885:Ppm1d APN 11 85326944 missense possibly damaging 0.52
IGL03085:Ppm1d APN 11 85337163 missense probably null 0.80
R0114:Ppm1d UTSW 11 85326905 missense probably damaging 1.00
R0606:Ppm1d UTSW 11 85345877 missense probably benign 0.27
R1014:Ppm1d UTSW 11 85337154 missense probably damaging 0.98
R1548:Ppm1d UTSW 11 85339605 missense probably damaging 1.00
R3774:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R3775:Ppm1d UTSW 11 85337167 missense probably damaging 1.00
R4025:Ppm1d UTSW 11 85345757 missense probably benign 0.09
R4067:Ppm1d UTSW 11 85345852 missense probably benign 0.01
R4118:Ppm1d UTSW 11 85311582 missense probably benign 0.01
R5169:Ppm1d UTSW 11 85332370 missense probably damaging 1.00
R5384:Ppm1d UTSW 11 85311783 missense probably damaging 0.98
R5861:Ppm1d UTSW 11 85311848 missense possibly damaging 0.70
R5890:Ppm1d UTSW 11 85326908 missense probably damaging 1.00
R6394:Ppm1d UTSW 11 85339672 missense probably benign
R6992:Ppm1d UTSW 11 85332352 missense probably damaging 1.00
R7006:Ppm1d UTSW 11 85337151 missense possibly damaging 0.92
R7297:Ppm1d UTSW 11 85345995 missense probably damaging 1.00
R7993:Ppm1d UTSW 11 85326951 missense probably damaging 1.00
R8099:Ppm1d UTSW 11 85339666 missense possibly damaging 0.51
R8697:Ppm1d UTSW 11 85337160 missense possibly damaging 0.95
R8738:Ppm1d UTSW 11 85345906 missense probably damaging 0.99
R9018:Ppm1d UTSW 11 85337135 missense probably damaging 0.98
R9188:Ppm1d UTSW 11 85345921 missense possibly damaging 0.93
Z1176:Ppm1d UTSW 11 85339573 missense probably benign 0.09
Z1177:Ppm1d UTSW 11 85326963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCACCGGAAGAAGATG -3'
(R):5'- AGCCATTTCGTCGGTGCTTC -3'

Sequencing Primer
(F):5'- GCTGAGCTCTAAGGACCATATACCTG -3'
(R):5'- CTTCTTCATAAGGGGGCCAGAG -3'
Posted On 2015-05-15