Incidental Mutation 'R4065:Dhx29'
ID316081
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 040972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4065 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 112964742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably null
Transcript: ENSMUST00000038574
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C T 3: 90,058,766 R178* probably null Het
Abcc9 T C 6: 142,645,890 E769G probably damaging Het
Adcy9 C A 16: 4,288,434 V939F probably damaging Het
Atg2a T C 19: 6,258,366 F1643S probably damaging Het
B430305J03Rik A G 3: 61,364,225 probably benign Het
C2cd5 A G 6: 143,073,671 I306T probably benign Het
Camk1d A T 2: 5,565,773 F26I probably damaging Het
Cant1 G T 11: 118,407,997 D313E probably benign Het
Dnah12 A G 14: 26,770,448 I1182V probably benign Het
Dnajc21 A G 15: 10,451,553 probably null Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Fat4 A T 3: 39,009,197 H4434L probably benign Het
Fbxo16 T A 14: 65,270,829 N31K probably damaging Het
Foxj3 T C 4: 119,610,009 I183T probably benign Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fshr T C 17: 88,985,966 Y428C probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Grem1 A G 2: 113,749,688 L156P probably damaging Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Lamc3 C A 2: 31,945,258 H1530Q probably benign Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mga T C 2: 119,947,002 V1846A probably damaging Het
Mthfd1l A G 10: 4,032,242 H483R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Mvp A G 7: 126,996,317 V207A probably damaging Het
Nsun2 T C 13: 69,612,460 probably null Het
Olfr541 T C 7: 140,704,269 L6P probably benign Het
Olfr972 T C 9: 39,873,422 I49T possibly damaging Het
Pcnx4 T C 12: 72,556,360 probably null Het
Plxna4 T A 6: 32,236,365 K637* probably null Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Prb1 T A 6: 132,207,695 Q325L unknown Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Spcs2 A G 7: 99,844,805 I164T possibly damaging Het
Ssbp4 T C 8: 70,599,560 T77A possibly damaging Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1 T A 17: 56,318,020 I521N probably damaging Het
Uros A G 7: 133,702,328 probably null Het
Usp47 A G 7: 112,053,416 D100G probably benign Het
Utp6 T C 11: 79,946,247 R337G probably damaging Het
Vcan T C 13: 89,679,887 T3147A probably damaging Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp654 G A 16: 64,785,925 T638M possibly damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0362:Dhx29 UTSW 13 112962859 missense probably benign
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGACATTGCTCTTCTTAAAGC -3'
(R):5'- GCCAGAGAGAAGCCTTGCTATC -3'

Sequencing Primer
(F):5'- GGACATTGCTCTTCTTAAAGCTGTGC -3'
(R):5'- GCGAGCAGAAGTAACAGTT -3'
Posted On2015-05-15