Incidental Mutation 'R4066:Adam23'
ID316094
Institutional Source Beutler Lab
Gene Symbol Adam23
Ensembl Gene ENSMUSG00000025964
Gene Namea disintegrin and metallopeptidase domain 23
SynonymsMDC3
MMRRC Submission 040973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4066 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63445891-63596276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63563425 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 582 (H582L)
Ref Sequence ENSEMBL: ENSMUSP00000109742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087374] [ENSMUST00000114103] [ENSMUST00000114107]
Predicted Effect probably damaging
Transcript: ENSMUST00000087374
AA Change: H582L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084633
Gene: ENSMUSG00000025964
AA Change: H582L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097717
SMART Domains Protein: ENSMUSP00000095324
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 2 63 6.3e-16 PFAM
Pfam:Reprolysin_5 111 286 2.7e-7 PFAM
Pfam:Reprolysin 112 309 5.7e-57 PFAM
Pfam:Reprolysin_3 136 240 8.7e-7 PFAM
DISIN 324 399 1.4e-30 SMART
ACR 400 541 3.6e-63 SMART
EGF 548 582 9e-2 SMART
transmembrane domain 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114101
SMART Domains Protein: ENSMUSP00000109736
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 87 247 1.3e-30 PFAM
Pfam:Reprolysin_5 295 470 3.3e-9 PFAM
Pfam:Reprolysin 296 493 8.1e-59 PFAM
Pfam:Reprolysin_3 320 426 1.1e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 686 4.34e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114103
AA Change: H582L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139862
Gene: ENSMUSG00000025964
AA Change: H582L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114107
AA Change: H582L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109742
Gene: ENSMUSG00000025964
AA Change: H582L

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 1.8e-30 PFAM
Pfam:Reprolysin_5 295 470 4.3e-9 PFAM
Pfam:Reprolysin 296 493 1.1e-58 PFAM
Pfam:Reprolysin_3 320 426 1.4e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
transmembrane domain 791 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182642
SMART Domains Protein: ENSMUSP00000138362
Gene: ENSMUSG00000025964

DomainStartEndE-ValueType
signal peptide 1 55 N/A INTRINSIC
Pfam:Pep_M12B_propep 89 247 2.2e-30 PFAM
Pfam:Reprolysin_5 295 470 4.6e-9 PFAM
Pfam:Reprolysin 296 493 1.4e-58 PFAM
Pfam:Reprolysin_3 320 426 1.6e-8 PFAM
DISIN 508 583 2.81e-28 SMART
ACR 584 725 1.11e-60 SMART
EGF 732 766 1.87e1 SMART
Meta Mutation Damage Score 0.8776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an inactive metalloprotease and disintegrin domains. Transgenic disruption of this gene in mice results in postnatal neurological defects including tremor and ataxia resulting in death by 2 weeks of age. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene are smaller than normal littermates, show delayed lung development, are lethal by postnatal day 14, and display severe tremor and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Lipo2 T C 19: 33,720,859 I373V probably benign Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1245 T A 2: 89,575,179 L182F probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y673H probably damaging Het
Shcbp1 A G 8: 4,748,716 I401T probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Togaram2 C A 17: 71,716,238 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Adam23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Adam23 APN 1 63570954 missense probably damaging 0.99
IGL00957:Adam23 APN 1 63534311 missense probably benign 0.27
IGL01338:Adam23 APN 1 63551855 missense possibly damaging 0.50
IGL01835:Adam23 APN 1 63543119 missense probably damaging 1.00
IGL01928:Adam23 APN 1 63557446 missense probably damaging 1.00
IGL02563:Adam23 APN 1 63567977 splice site probably benign
IGL02981:Adam23 APN 1 63570953 missense probably damaging 0.99
IGL03037:Adam23 APN 1 63571017 missense possibly damaging 0.63
IGL03176:Adam23 APN 1 63563416 missense probably damaging 1.00
IGL02991:Adam23 UTSW 1 63547819 critical splice donor site probably null
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0057:Adam23 UTSW 1 63570919 missense probably damaging 1.00
R0125:Adam23 UTSW 1 63534356 missense probably benign 0.00
R0477:Adam23 UTSW 1 63557400 splice site probably benign
R0538:Adam23 UTSW 1 63567844 splice site probably benign
R0617:Adam23 UTSW 1 63543147 missense probably benign 0.06
R1506:Adam23 UTSW 1 63547814 missense probably benign 0.01
R1599:Adam23 UTSW 1 63570933 missense possibly damaging 0.65
R1755:Adam23 UTSW 1 63543170 missense probably damaging 1.00
R1813:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1858:Adam23 UTSW 1 63557456 missense probably benign 0.12
R1896:Adam23 UTSW 1 63545572 missense probably benign 0.07
R1943:Adam23 UTSW 1 63477757 critical splice donor site probably null
R2147:Adam23 UTSW 1 63534362 splice site probably null
R2211:Adam23 UTSW 1 63573129 intron probably benign
R2233:Adam23 UTSW 1 63545512 missense probably benign
R2249:Adam23 UTSW 1 63535176 nonsense probably null
R2363:Adam23 UTSW 1 63557491 splice site probably null
R3800:Adam23 UTSW 1 63551774 nonsense probably null
R3974:Adam23 UTSW 1 63547729 nonsense probably null
R3975:Adam23 UTSW 1 63547729 nonsense probably null
R4382:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4383:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4384:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R4385:Adam23 UTSW 1 63566628 missense probably damaging 1.00
R5385:Adam23 UTSW 1 63551811 missense possibly damaging 0.74
R5435:Adam23 UTSW 1 63546453 missense possibly damaging 0.73
R6465:Adam23 UTSW 1 63566668 missense probably damaging 1.00
R6490:Adam23 UTSW 1 63557454 missense probably damaging 1.00
R6967:Adam23 UTSW 1 63563336 intron probably null
R7139:Adam23 UTSW 1 63545577 missense probably damaging 1.00
R7584:Adam23 UTSW 1 63545462 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCCATCTCCTGGTAAACAG -3'
(R):5'- AACCTGTCGCTGGTTAGAC -3'

Sequencing Primer
(F):5'- GTGTTTTTCCGAATGTTCCT -3'
(R):5'- GCTGGTTAGACAGATGTAATATTTGC -3'
Posted On2015-05-15