Incidental Mutation 'R4066:Olfr1245'
ID316100
Institutional Source Beutler Lab
Gene Symbol Olfr1245
Ensembl Gene ENSMUSG00000111456
Gene Nameolfactory receptor 1245
SynonymsGA_x6K02T2Q125-51020951-51020028, MOR231-12
MMRRC Submission 040973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4066 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89573406-89578447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89575179 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 182 (L182F)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: L182F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,563,425 H582L probably damaging Het
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Lipo2 T C 19: 33,720,859 I373V probably benign Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y673H probably damaging Het
Shcbp1 A G 8: 4,748,716 I401T probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Togaram2 C A 17: 71,716,238 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Olfr1245
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Olfr1245 APN 2 89575423 missense possibly damaging 0.68
IGL01690:Olfr1245 APN 2 89575213 missense probably benign 0.09
IGL02334:Olfr1245 APN 2 89575324 missense possibly damaging 0.95
IGL02435:Olfr1245 APN 2 89575546 missense probably damaging 0.99
IGL02793:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL02875:Olfr1245 APN 2 89575552 missense probably damaging 1.00
IGL03218:Olfr1245 APN 2 89575591 missense probably benign 0.09
IGL03392:Olfr1245 APN 2 89575249 missense probably damaging 0.96
H8786:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
I0000:Olfr1245 UTSW 2 89575153 missense probably damaging 1.00
R0044:Olfr1245 UTSW 2 89575630 missense possibly damaging 0.68
R0190:Olfr1245 UTSW 2 89574958 missense probably damaging 0.98
R1585:Olfr1245 UTSW 2 89575402 missense possibly damaging 0.89
R1902:Olfr1245 UTSW 2 89575603 missense possibly damaging 0.77
R2018:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2019:Olfr1245 UTSW 2 89575393 missense probably damaging 0.97
R2020:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2021:Olfr1245 UTSW 2 89574961 missense possibly damaging 0.88
R2030:Olfr1245 UTSW 2 89575214 missense probably benign 0.00
R2133:Olfr1245 UTSW 2 89575256 nonsense probably null
R3850:Olfr1245 UTSW 2 89575034 missense probably damaging 0.99
R4754:Olfr1245 UTSW 2 89575047 missense probably benign
R4923:Olfr1245 UTSW 2 89575679 missense probably damaging 0.98
R5303:Olfr1245 UTSW 2 89575001 missense possibly damaging 0.88
R5574:Olfr1245 UTSW 2 89574977 missense possibly damaging 0.94
R6083:Olfr1245 UTSW 2 89575672 missense probably benign 0.42
R6188:Olfr1245 UTSW 2 89575194 nonsense probably null
R6724:Olfr1245 UTSW 2 89574965 missense probably benign 0.26
R6964:Olfr1245 UTSW 2 89574989 missense probably benign
R7066:Olfr1245 UTSW 2 89575703 missense probably damaging 0.98
R7401:Olfr1245 UTSW 2 89575105 missense probably benign 0.27
R8232:Olfr1245 UTSW 2 89575594 missense noncoding transcript
R8558:Olfr1245 UTSW 2 89574985 missense probably damaging 1.00
R8708:Olfr1245 UTSW 2 89575279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAAACTGGTCGGGCATAC -3'
(R):5'- AAGCCACTGCACTATTTGGC -3'

Sequencing Primer
(F):5'- CTGGTCGGGCATACATAAAAATAC -3'
(R):5'- CCATCATGAATCGAAGGGTTTGC -3'
Posted On2015-05-15