Incidental Mutation 'R4066:Or4a72'
ID 316100
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040973-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R4066 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89405523 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 182 (L182F)
Ref Sequence ENSEMBL: ENSMUSP00000150791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: L182F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: L182F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,602,584 (GRCm39) H582L probably damaging Het
Ankrd13d C T 19: 4,320,388 (GRCm39) A118T probably benign Het
Arhgap30 C T 1: 171,235,891 (GRCm39) T755I probably benign Het
Cab39l A G 14: 59,784,454 (GRCm39) H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,690,738 (GRCm39) probably benign Het
Dspp T A 5: 104,325,060 (GRCm39) N474K unknown Het
Fanci T C 7: 79,062,505 (GRCm39) probably null Het
Fras1 T A 5: 96,918,542 (GRCm39) I3526K possibly damaging Het
Fut8 T A 12: 77,510,835 (GRCm39) Y421N probably damaging Het
Gm12258 C T 11: 58,749,352 (GRCm39) L176F probably benign Het
Gm8220 A T 14: 44,523,095 (GRCm39) R12* probably null Het
Hecw1 T C 13: 14,491,016 (GRCm39) S659G probably damaging Het
Hnrnpr C A 4: 136,066,657 (GRCm39) probably benign Het
Htt C T 5: 35,036,191 (GRCm39) T2046I probably benign Het
Kat7 T C 11: 95,174,967 (GRCm39) D259G possibly damaging Het
Klra9 T C 6: 130,165,707 (GRCm39) T103A probably benign Het
Lad1 A G 1: 135,755,165 (GRCm39) E147G probably damaging Het
Lipo2 T C 19: 33,698,259 (GRCm39) I373V probably benign Het
Ltb4r1 G T 14: 56,004,952 (GRCm39) W85L probably damaging Het
Ltn1 T C 16: 87,213,118 (GRCm39) Y481C possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Muc4 A T 16: 32,569,869 (GRCm39) I310F possibly damaging Het
Myl10 A G 5: 136,724,304 (GRCm39) K70E probably damaging Het
Nptx2 G T 5: 144,493,122 (GRCm39) W403L probably damaging Het
Nyap2 A G 1: 81,219,550 (GRCm39) Y524C probably damaging Het
Or6b2b A G 1: 92,418,911 (GRCm39) C189R probably damaging Het
Or8b1 T A 9: 38,399,778 (GRCm39) M151K probably benign Het
Pde9a A G 17: 31,662,812 (GRCm39) *64W probably null Het
Ppp2r5b T C 19: 6,279,360 (GRCm39) Y379C probably damaging Het
Rd3l T G 12: 111,945,945 (GRCm39) N178T probably benign Het
Recql4 A G 15: 76,590,027 (GRCm39) Y673H probably damaging Het
Rnps1-ps T A 6: 7,983,009 (GRCm39) noncoding transcript Het
Shcbp1 A G 8: 4,798,716 (GRCm39) I401T probably damaging Het
Shd A T 17: 56,278,581 (GRCm39) D48V probably damaging Het
Slc14a1 A G 18: 78,154,592 (GRCm39) W209R probably damaging Het
Slc2a9 T C 5: 38,640,692 (GRCm39) K6E probably benign Het
Slco6d1 A G 1: 98,391,571 (GRCm39) probably benign Het
Spic T C 10: 88,511,545 (GRCm39) H237R possibly damaging Het
Stau2 A G 1: 16,464,283 (GRCm39) S156P possibly damaging Het
Stmn2 T C 3: 8,574,668 (GRCm39) probably benign Het
Togaram2 C A 17: 72,023,233 (GRCm39) probably benign Het
Trpc5 T A X: 143,202,594 (GRCm39) R545* probably null Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Wdfy3 C T 5: 102,070,313 (GRCm39) V1152I probably benign Het
Xpo4 G T 14: 57,825,511 (GRCm39) H939N probably benign Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R3850:Or4a72 UTSW 2 89,405,378 (GRCm39) missense probably damaging 0.99
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAAACTGGTCGGGCATAC -3'
(R):5'- AAGCCACTGCACTATTTGGC -3'

Sequencing Primer
(F):5'- CTGGTCGGGCATACATAAAAATAC -3'
(R):5'- CCATCATGAATCGAAGGGTTTGC -3'
Posted On 2015-05-15