Mutagenetix > Incidental Mutation

Incidental Mutation 'R4066:Hnrnpr'

316105

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpr

Ensembl Gene

ENSMUSG00000066037

Gene Name

heterogeneous nuclear ribonucleoprotein R

Synonyms

hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik

MMRRC Submission

040973-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136310942-136359447 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to A at 136339346 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000131671] [ENSMUST00000148843]

AlphaFold

Q8VHM5

Predicted Effect

probably benign
Transcript: ENSMUST00000084219

SMART Domains

Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105850

SMART Domains

Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131671

SMART Domains

Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037

Domain	Start	End	E-Value	Type
RRM	65	139	1.27e-16	SMART
RRM	146	223	9.42e-11	SMART
RRM	241	306	3.76e-19	SMART
low complexity region	318	327	N/A	INTRINSIC
low complexity region	332	395	N/A	INTRINSIC
low complexity region	398	426	N/A	INTRINSIC
low complexity region	430	473	N/A	INTRINSIC
low complexity region	503	519	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148843

SMART Domains

Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153505

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182327

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	T	1: 63,563,425	H582L	probably damaging	Het
Ankrd13d	C	T	19: 4,270,360	A118T	probably benign	Het
Arhgap30	C	T	1: 171,408,323	T755I	probably benign	Het
Cab39l	A	G	14: 59,547,005	H285R	probably benign	Het
Dpyd	AAT	AATGTATATATAT	3: 118,897,089		probably benign	Het
Dspp	T	A	5: 104,177,194	N474K	unknown	Het
Fanci	T	C	7: 79,412,757		probably null	Het
Fras1	T	A	5: 96,770,683	I3526K	possibly damaging	Het
Fut8	T	A	12: 77,464,061	Y421N	probably damaging	Het
Gm12258	C	T	11: 58,858,526	L176F	probably benign	Het
Gm8220	A	T	14: 44,285,638	R12*	probably null	Het
Gm9825	T	A	6: 7,983,009		noncoding transcript	Het
Hecw1	T	C	13: 14,316,431	S659G	probably damaging	Het
Htt	C	T	5: 34,878,847	T2046I	probably benign	Het
Kat7	T	C	11: 95,284,141	D259G	possibly damaging	Het
Klra9	T	C	6: 130,188,744	T103A	probably benign	Het
Lad1	A	G	1: 135,827,427	E147G	probably damaging	Het
Lipo2	T	C	19: 33,720,859	I373V	probably benign	Het
Ltb4r1	G	T	14: 55,767,495	W85L	probably damaging	Het
Ltn1	T	C	16: 87,416,230	Y481C	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Muc4	A	T	16: 32,751,051	I310F	possibly damaging	Het
Myl10	A	G	5: 136,695,450	K70E	probably damaging	Het
Nptx2	G	T	5: 144,556,312	W403L	probably damaging	Het
Nyap2	A	G	1: 81,241,835	Y524C	probably damaging	Het
Olfr1245	T	A	2: 89,575,179	L182F	probably damaging	Het
Olfr1415	A	G	1: 92,491,189	C189R	probably damaging	Het
Olfr906	T	A	9: 38,488,482	M151K	probably benign	Het
Pde9a	A	G	17: 31,443,838	*64W	probably null	Het
Ppp2r5b	T	C	19: 6,229,330	Y379C	probably damaging	Het
Rd3l	T	G	12: 111,979,511	N178T	probably benign	Het
Recql4	A	G	15: 76,705,827	Y673H	probably damaging	Het
Shcbp1	A	G	8: 4,748,716	I401T	probably damaging	Het
Shd	A	T	17: 55,971,581	D48V	probably damaging	Het
Slc14a1	A	G	18: 78,111,377	W209R	probably damaging	Het
Slc2a9	T	C	5: 38,483,349	K6E	probably benign	Het
Slco6d1	A	G	1: 98,463,846		probably benign	Het
Spic	T	C	10: 88,675,683	H237R	possibly damaging	Het
Stau2	A	G	1: 16,394,059	S156P	possibly damaging	Het
Stmn2	T	C	3: 8,509,608		probably benign	Het
Togaram2	C	A	17: 71,716,238		probably benign	Het
Trpc5	T	A	X: 144,419,598	R545*	probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Wdfy3	C	T	5: 101,922,447	V1152I	probably benign	Het
Xpo4	G	T	14: 57,588,054	H939N	probably benign	Het

Other mutations in Hnrnpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Hnrnpr	APN	4	136339545	missense	unknown
IGL00844:Hnrnpr	APN	4	136339205	missense	probably benign	0.17
IGL01374:Hnrnpr	APN	4	136327418	splice site	probably benign
IGL01704:Hnrnpr	APN	4	136329381	missense	possibly damaging	0.89
IGL01825:Hnrnpr	APN	4	136339539	nonsense	probably null
IGL01843:Hnrnpr	APN	4	136339413	splice site	probably benign
IGL01871:Hnrnpr	APN	4	136339574	missense	unknown
IGL02376:Hnrnpr	APN	4	136319455	missense	probably damaging	1.00
IGL02557:Hnrnpr	APN	4	136319506	missense	probably damaging	1.00
IGL02947:Hnrnpr	APN	4	136316379	missense	probably damaging	1.00
PIT4677001:Hnrnpr	UTSW	4	136329439	missense	probably damaging	1.00
R0142:Hnrnpr	UTSW	4	136327282	missense	probably damaging	1.00
R0219:Hnrnpr	UTSW	4	136339163	splice site	probably benign
R1459:Hnrnpr	UTSW	4	136329444	missense	probably damaging	1.00
R1917:Hnrnpr	UTSW	4	136332488	nonsense	probably null
R2007:Hnrnpr	UTSW	4	136319513	unclassified	probably benign
R2364:Hnrnpr	UTSW	4	136327329	missense	possibly damaging	0.69
R3788:Hnrnpr	UTSW	4	136336313	missense	probably damaging	1.00
R4232:Hnrnpr	UTSW	4	136339189	missense	probably benign	0.15
R4433:Hnrnpr	UTSW	4	136317148	missense	probably benign	0.04
R4664:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R4990:Hnrnpr	UTSW	4	136329379	missense	probably damaging	1.00
R4990:Hnrnpr	UTSW	4	136336298	missense	probably damaging	1.00
R5058:Hnrnpr	UTSW	4	136336337	missense	possibly damaging	0.89
R5328:Hnrnpr	UTSW	4	136339216	missense	probably benign	0.01
R5469:Hnrnpr	UTSW	4	136319434	missense	probably damaging	1.00
R5641:Hnrnpr	UTSW	4	136332487	missense	probably damaging	0.97
R7067:Hnrnpr	UTSW	4	136327393	missense	probably damaging	1.00
R7250:Hnrnpr	UTSW	4	136332435	missense	probably benign	0.45
R7254:Hnrnpr	UTSW	4	136332575	missense	possibly damaging	0.92
R8213:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R8942:Hnrnpr	UTSW	4	136332480	missense	possibly damaging	0.95
R9008:Hnrnpr	UTSW	4	136329426	missense	probably damaging	0.97
R9502:Hnrnpr	UTSW	4	136329370	missense	probably damaging	0.99
R9515:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00
R9516:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTCTTTCTGGCTAGGC -3'
(R):5'- TGGAGGGTAGCCATATCCAC -3'

Sequencing Primer
(F):5'- CAGCATATGCCCTTAACTGTTGAG -3'
(R):5'- GAGGGTAGCCATATCCACCTCTC -3'

Posted On

2015-05-15