Mutagenetix > Incidental Mutations

Incidental Mutation 'R4066:Dspp'

316111

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

MMRRC Submission

040973-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4066 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104177194 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 474 (N474K)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

Predicted Effect

unknown
Transcript: ENSMUST00000112771
AA Change: N474K

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: N474K

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Meta Mutation Damage Score

0.1207

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	A	T	1: 63,563,425	H582L	probably damaging	Het
Ankrd13d	C	T	19: 4,270,360	A118T	probably benign	Het
Arhgap30	C	T	1: 171,408,323	T755I	probably benign	Het
Cab39l	A	G	14: 59,547,005	H285R	probably benign	Het
Dpyd	AAT	AATGTATATATAT	3: 118,897,089		probably benign	Het
Fanci	T	C	7: 79,412,757		probably null	Het
Fras1	T	A	5: 96,770,683	I3526K	possibly damaging	Het
Fut8	T	A	12: 77,464,061	Y421N	probably damaging	Het
Gm12258	C	T	11: 58,858,526	L176F	probably benign	Het
Gm8220	A	T	14: 44,285,638	R12*	probably null	Het
Gm9825	T	A	6: 7,983,009		noncoding transcript	Het
Hecw1	T	C	13: 14,316,431	S659G	probably damaging	Het
Hnrnpr	C	A	4: 136,339,346		probably benign	Het
Htt	C	T	5: 34,878,847	T2046I	probably benign	Het
Kat7	T	C	11: 95,284,141	D259G	possibly damaging	Het
Klra9	T	C	6: 130,188,744	T103A	probably benign	Het
Lad1	A	G	1: 135,827,427	E147G	probably damaging	Het
Lipo2	T	C	19: 33,720,859	I373V	probably benign	Het
Ltb4r1	G	T	14: 55,767,495	W85L	probably damaging	Het
Ltn1	T	C	16: 87,416,230	Y481C	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Muc4	A	T	16: 32,751,051	I310F	possibly damaging	Het
Myl10	A	G	5: 136,695,450	K70E	probably damaging	Het
Nptx2	G	T	5: 144,556,312	W403L	probably damaging	Het
Nyap2	A	G	1: 81,241,835	Y524C	probably damaging	Het
Olfr1245	T	A	2: 89,575,179	L182F	probably damaging	Het
Olfr1415	A	G	1: 92,491,189	C189R	probably damaging	Het
Olfr906	T	A	9: 38,488,482	M151K	probably benign	Het
Pde9a	A	G	17: 31,443,838	*64W	probably null	Het
Ppp2r5b	T	C	19: 6,229,330	Y379C	probably damaging	Het
Rd3l	T	G	12: 111,979,511	N178T	probably benign	Het
Recql4	A	G	15: 76,705,827	Y673H	probably damaging	Het
Shcbp1	A	G	8: 4,748,716	I401T	probably damaging	Het
Shd	A	T	17: 55,971,581	D48V	probably damaging	Het
Slc14a1	A	G	18: 78,111,377	W209R	probably damaging	Het
Slc2a9	T	C	5: 38,483,349	K6E	probably benign	Het
Slco6d1	A	G	1: 98,463,846		probably benign	Het
Spic	T	C	10: 88,675,683	H237R	possibly damaging	Het
Stau2	A	G	1: 16,394,059	S156P	possibly damaging	Het
Stmn2	T	C	3: 8,509,608		probably benign	Het
Togaram2	C	A	17: 71,716,238		probably benign	Het
Trpc5	T	A	X: 144,419,598	R545*	probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Wdfy3	C	T	5: 101,922,447	V1152I	probably benign	Het
Xpo4	G	T	14: 57,588,054	H939N	probably benign	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5008:Dspp	UTSW	5	104175573	missense	possibly damaging	0.66
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5359:Dspp	UTSW	5	104175886	missense	probably damaging	0.98
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R5992:Dspp	UTSW	5	104178451	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6362:Dspp	UTSW	5	104176034	missense	probably benign	0.19
R6736:Dspp	UTSW	5	104178175	missense	unknown
R6805:Dspp	UTSW	5	104175850	missense	probably benign	0.03
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01
R7585:Dspp	UTSW	5	104175525	missense	possibly damaging	0.90
R7662:Dspp	UTSW	5	104177870	missense	unknown
R7739:Dspp	UTSW	5	104178146	missense	unknown
R7755:Dspp	UTSW	5	104178361	small deletion	probably benign
R7805:Dspp	UTSW	5	104175393	missense	probably damaging	0.99
R7869:Dspp	UTSW	5	104175665	missense	probably damaging	0.99
R7945:Dspp	UTSW	5	104178361	small deletion	probably benign
R7978:Dspp	UTSW	5	104178361	small deletion	probably benign
R8088:Dspp	UTSW	5	104177256	missense	unknown
R8254:Dspp	UTSW	5	104175328	missense	possibly damaging	0.94
R8257:Dspp	UTSW	5	104177001	missense	probably benign	0.01
R8439:Dspp	UTSW	5	104177296	missense	unknown
R8486:Dspp	UTSW	5	104174017	start gained	probably benign
RF007:Dspp	UTSW	5	104178361	small deletion	probably benign
RF044:Dspp	UTSW	5	104178424	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAGGCACTGCTGAGAAATCAG -3'
(R):5'- TTGTCATGGTCACTGCTGTCAG -3'

Sequencing Primer
(F):5'- AGCTGCCCACAGTAACCTGG -3'
(R):5'- CATGGTCACTGCTGTCAGATTCG -3'

Posted On

2015-05-15