Incidental Mutation 'R4066:Shcbp1'
ID316118
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission 040973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4066 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4748716 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 401 (I401T)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably damaging
Transcript: ENSMUST00000022945
AA Change: I401T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: I401T

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect unknown
Transcript: ENSMUST00000207876
AA Change: I134T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.3542 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,563,425 H582L probably damaging Het
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Lipo2 T C 19: 33,720,859 I373V probably benign Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1245 T A 2: 89,575,179 L182F probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y673H probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Togaram2 C A 17: 71,716,238 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 splice site probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6366:Shcbp1 UTSW 8 4749380 missense probably damaging 1.00
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
R7943:Shcbp1 UTSW 8 4748812 missense possibly damaging 0.78
R8114:Shcbp1 UTSW 8 4767930 missense probably damaging 1.00
R8386:Shcbp1 UTSW 8 4767951 missense probably damaging 1.00
R8435:Shcbp1 UTSW 8 4748734 missense probably benign 0.04
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Z1176:Shcbp1 UTSW 8 4765056 missense possibly damaging 0.59
Z1177:Shcbp1 UTSW 8 4736146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGATCAAAGGTTCGACAC -3'
(R):5'- GTGACAAGCACACAACTGAG -3'

Sequencing Primer
(F):5'- TCAAAGGTTCGACACTTATAGGG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-05-15