Incidental Mutation 'R4066:Lipo2'
ID316138
Institutional Source Beutler Lab
Gene Symbol Lipo2
Ensembl Gene ENSMUSG00000087303
Gene Namelipase, member O2
SynonymsGm8981
MMRRC Submission 040973-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4066 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33719670-33769142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33720859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 373 (I373V)
Ref Sequence ENSEMBL: ENSMUSP00000118907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000147153]
Predicted Effect probably benign
Transcript: ENSMUST00000025694
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147153
AA Change: I373V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118907
Gene: ENSMUSG00000087303
AA Change: I373V

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.4e-24 PFAM
Pfam:Abhydrolase_1 76 213 1.7e-15 PFAM
Pfam:Abhydrolase_5 76 370 1.5e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,563,425 H582L probably damaging Het
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dpyd AAT AATGTATATATAT 3: 118,897,089 probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1245 T A 2: 89,575,179 L182F probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y673H probably damaging Het
Shcbp1 A G 8: 4,748,716 I401T probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Togaram2 C A 17: 71,716,238 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Lipo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Lipo2 APN 19 33721024 missense probably benign 0.03
IGL01780:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL01868:Lipo2 APN 19 33730838 missense probably benign 0.00
IGL02291:Lipo2 APN 19 33745792 missense possibly damaging 0.80
IGL02350:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02357:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL02560:Lipo2 APN 19 33730948 missense possibly damaging 0.82
IGL03354:Lipo2 APN 19 33730870 missense probably benign 0.09
R0183:Lipo2 UTSW 19 33749551 splice site probably null
R0529:Lipo2 UTSW 19 33746935 missense probably benign 0.05
R0576:Lipo2 UTSW 19 33749424 missense probably benign 0.02
R0579:Lipo2 UTSW 19 33746898 missense probably damaging 0.99
R0594:Lipo2 UTSW 19 33746902 missense possibly damaging 0.95
R0621:Lipo2 UTSW 19 33730939 missense probably damaging 1.00
R1019:Lipo2 UTSW 19 33730857 nonsense probably null
R2190:Lipo2 UTSW 19 33748569 missense probably damaging 1.00
R2413:Lipo2 UTSW 19 33751257 missense probably damaging 0.98
R4258:Lipo2 UTSW 19 33730928 missense possibly damaging 0.88
R4365:Lipo2 UTSW 19 33721708 missense probably damaging 1.00
R4491:Lipo2 UTSW 19 33721700 missense probably damaging 0.99
R4640:Lipo2 UTSW 19 33720837 missense probably benign 0.04
R4822:Lipo2 UTSW 19 33745751 missense probably benign 0.01
R4872:Lipo2 UTSW 19 33749514 missense probably benign 0.00
R5004:Lipo2 UTSW 19 33721676 critical splice donor site probably null
R5112:Lipo2 UTSW 19 33748465 missense probably benign 0.00
R5440:Lipo2 UTSW 19 33720858 missense probably benign 0.39
R5737:Lipo2 UTSW 19 33721696 missense probably damaging 1.00
R6209:Lipo2 UTSW 19 33749452 missense probably damaging 1.00
R6868:Lipo2 UTSW 19 33748462 missense possibly damaging 0.86
R6893:Lipo2 UTSW 19 33721007 nonsense probably null
R7176:Lipo2 UTSW 19 33745807 missense possibly damaging 0.71
R7853:Lipo2 UTSW 19 33759944 start gained probably benign
R7936:Lipo2 UTSW 19 33759944 start gained probably benign
X0052:Lipo2 UTSW 19 33720945 missense probably damaging 1.00
Z1088:Lipo2 UTSW 19 33721685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACATTCCCTTGATGGTCATAG -3'
(R):5'- GACAAGGGCCAAGCTCAATG -3'

Sequencing Primer
(F):5'- CCCTTGATGGTCATAGTTTTCAC -3'
(R):5'- GGGCCAAGCTCAATGATTTC -3'
Posted On2015-05-15