Incidental Mutation 'R4067:Plekha6'
ID 316142
Institutional Source Beutler Lab
Gene Symbol Plekha6
Ensembl Gene ENSMUSG00000041757
Gene Name pleckstrin homology domain containing, family A member 6
Synonyms Pepp3
MMRRC Submission 040853-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.173) question?
Stock # R4067 (G1)
Quality Score 140
Status Validated
Chromosome 1
Chromosomal Location 133091948-133231173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 133222416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1001 (E1001K)
Ref Sequence ENSEMBL: ENSMUSP00000140558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038295] [ENSMUST00000105082] [ENSMUST00000186917] [ENSMUST00000187285]
AlphaFold Q7TQG1
Predicted Effect probably benign
Transcript: ENSMUST00000038295
AA Change: E1126K

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048214
Gene: ENSMUSG00000041757
AA Change: E1126K

DomainStartEndE-ValueType
PH 60 160 2.23e-20 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
Blast:PH 506 576 6e-31 BLAST
coiled coil region 613 686 N/A INTRINSIC
low complexity region 761 782 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105082
AA Change: E1022K

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100703
Gene: ENSMUSG00000041757
AA Change: E1022K

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186917
AA Change: E1022K

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139794
Gene: ENSMUSG00000041757
AA Change: E1022K

DomainStartEndE-ValueType
PH 60 180 1.24e-18 SMART
low complexity region 237 251 N/A INTRINSIC
low complexity region 373 387 N/A INTRINSIC
coiled coil region 559 632 N/A INTRINSIC
low complexity region 707 728 N/A INTRINSIC
low complexity region 1035 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187285
AA Change: E1001K

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140558
Gene: ENSMUSG00000041757
AA Change: E1001K

DomainStartEndE-ValueType
PH 60 160 9.6e-23 SMART
low complexity region 217 231 N/A INTRINSIC
low complexity region 353 367 N/A INTRINSIC
coiled coil region 539 612 N/A INTRINSIC
low complexity region 687 708 N/A INTRINSIC
low complexity region 1014 1028 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190186
AA Change: E853K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190884
Meta Mutation Damage Score 0.4460 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,769,150 (GRCm39) T121S possibly damaging Het
4930503E14Rik T C 14: 44,406,641 (GRCm39) E136G probably damaging Het
Adgrg4 A G X: 56,005,320 (GRCm39) N2527S probably damaging Het
Ak1 G A 2: 32,519,593 (GRCm39) S7N probably benign Het
Aktip A C 8: 91,852,466 (GRCm39) I230R possibly damaging Het
Alms1 A G 6: 85,598,271 (GRCm39) I1032M probably damaging Het
Asb4 T A 6: 5,423,651 (GRCm39) V266E probably damaging Het
Bace1 G A 9: 45,765,962 (GRCm39) V130M probably damaging Het
Bglap A T 3: 88,291,744 (GRCm39) probably benign Het
Brpf3 T C 17: 29,040,233 (GRCm39) S885P probably benign Het
Chd9 A T 8: 91,750,202 (GRCm39) I1742F possibly damaging Het
Col9a2 T A 4: 120,909,586 (GRCm39) I415N probably damaging Het
Cybc1 A T 11: 121,115,528 (GRCm39) probably null Het
Dnajc7 T C 11: 100,492,607 (GRCm39) Y38C probably benign Het
Dync2i2 A G 2: 29,922,820 (GRCm39) L309P probably benign Het
Enam A G 5: 88,651,236 (GRCm39) Y840C probably damaging Het
Etnppl T A 3: 130,425,442 (GRCm39) C416S probably damaging Het
Fgf20 A T 8: 40,732,896 (GRCm39) S181T probably benign Het
Fut8 T A 12: 77,510,835 (GRCm39) Y421N probably damaging Het
Gcn1 T G 5: 115,737,147 (GRCm39) L1295R probably damaging Het
Gm11437 A G 11: 84,055,337 (GRCm39) V93A probably benign Het
Gm9989 T C 3: 81,829,549 (GRCm39) noncoding transcript Het
Gsdmc4 A T 15: 63,765,736 (GRCm39) probably null Het
Gvin3 T A 7: 106,198,772 (GRCm39) noncoding transcript Het
Ighv10-1 A T 12: 114,442,643 (GRCm39) M114K probably benign Het
Il22b T C 10: 118,126,115 (GRCm39) I161V probably damaging Het
Itfg2 T A 6: 128,387,413 (GRCm39) probably benign Het
Kirrel1 G A 3: 86,995,774 (GRCm39) Q387* probably null Het
Klk1 C T 7: 43,876,968 (GRCm39) R24* probably null Het
Klra7 T C 6: 130,208,612 (GRCm39) probably null Het
Ltn1 T C 16: 87,213,118 (GRCm39) Y481C possibly damaging Het
Man1c1 G C 4: 134,430,749 (GRCm39) P11R probably damaging Het
Mrps2 A G 2: 28,359,782 (GRCm39) N213S probably benign Het
Muc4 A T 16: 32,569,869 (GRCm39) I310F possibly damaging Het
Ntrk3 T A 7: 78,167,185 (GRCm39) Y102F probably damaging Het
Or8k24 A T 2: 86,216,431 (GRCm39) C110* probably null Het
Otof C T 5: 30,556,635 (GRCm39) G282D probably damaging Het
Pcdhb2 A T 18: 37,430,367 (GRCm39) probably null Het
Pign A T 1: 105,515,703 (GRCm39) probably null Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Ppm1d A G 11: 85,236,678 (GRCm39) T486A probably benign Het
Pudp A G 18: 50,701,329 (GRCm39) F135L probably benign Het
Rd3l T G 12: 111,945,945 (GRCm39) N178T probably benign Het
Rel A C 11: 23,703,215 (GRCm39) probably null Het
Sf3a1 T A 11: 4,117,824 (GRCm39) F195L probably damaging Het
Slc30a1 G C 1: 191,639,401 (GRCm39) A95P probably damaging Het
Slc47a2 T C 11: 61,194,773 (GRCm39) T469A probably benign Het
Slc4a10 A T 2: 61,876,989 (GRCm39) M1L probably benign Het
Slc8a1 T A 17: 81,955,703 (GRCm39) D445V probably damaging Het
Slc9a7 C T X: 20,071,793 (GRCm39) G113R probably damaging Het
Spata31e5 T A 1: 28,816,712 (GRCm39) D440V probably damaging Het
Spic T C 10: 88,511,545 (GRCm39) H237R possibly damaging Het
Stk26 A G X: 49,977,910 (GRCm39) E317G probably benign Het
Tex10 A T 4: 48,459,355 (GRCm39) Y506* probably null Het
Trhde T A 10: 114,280,585 (GRCm39) R848* probably null Het
Trpc5 T A X: 143,202,594 (GRCm39) R545* probably null Het
Usp24 C T 4: 106,216,286 (GRCm39) T379M possibly damaging Het
Zfp783 A T 6: 47,922,499 (GRCm39) noncoding transcript Het
Other mutations in Plekha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Plekha6 APN 1 133,209,903 (GRCm39) missense possibly damaging 0.92
IGL01328:Plekha6 APN 1 133,200,074 (GRCm39) splice site probably null
IGL01739:Plekha6 APN 1 133,187,869 (GRCm39) missense probably benign 0.38
IGL01803:Plekha6 APN 1 133,200,152 (GRCm39) nonsense probably null
IGL02053:Plekha6 APN 1 133,200,230 (GRCm39) missense probably damaging 1.00
IGL02269:Plekha6 APN 1 133,215,587 (GRCm39) missense possibly damaging 0.82
IGL02276:Plekha6 APN 1 133,221,599 (GRCm39) missense possibly damaging 0.93
IGL02478:Plekha6 APN 1 133,211,031 (GRCm39) missense probably benign 0.03
IGL02754:Plekha6 APN 1 133,212,676 (GRCm39) missense probably damaging 0.98
G1Funyon:Plekha6 UTSW 1 133,192,425 (GRCm39) missense probably damaging 0.96
R0100:Plekha6 UTSW 1 133,197,915 (GRCm39) missense probably damaging 0.99
R0334:Plekha6 UTSW 1 133,209,918 (GRCm39) missense probably benign 0.24
R0470:Plekha6 UTSW 1 133,200,045 (GRCm39) missense probably benign 0.07
R1016:Plekha6 UTSW 1 133,187,832 (GRCm39) missense probably benign 0.00
R1254:Plekha6 UTSW 1 133,200,327 (GRCm39) missense probably benign 0.10
R1728:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1729:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1730:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1739:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1762:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1771:Plekha6 UTSW 1 133,201,651 (GRCm39) missense probably benign 0.00
R1783:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1784:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1785:Plekha6 UTSW 1 133,215,584 (GRCm39) missense probably benign
R1786:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R1997:Plekha6 UTSW 1 133,191,556 (GRCm39) missense probably benign 0.43
R2020:Plekha6 UTSW 1 133,212,708 (GRCm39) missense possibly damaging 0.55
R2130:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2131:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2133:Plekha6 UTSW 1 133,207,103 (GRCm39) splice site probably null
R2992:Plekha6 UTSW 1 133,222,396 (GRCm39) missense probably damaging 1.00
R3781:Plekha6 UTSW 1 133,222,393 (GRCm39) missense probably damaging 1.00
R3810:Plekha6 UTSW 1 133,201,717 (GRCm39) missense probably benign
R4725:Plekha6 UTSW 1 133,211,058 (GRCm39) missense probably damaging 1.00
R5657:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5658:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5746:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5768:Plekha6 UTSW 1 133,208,116 (GRCm39) missense probably benign 0.01
R5785:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5892:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5937:Plekha6 UTSW 1 133,187,839 (GRCm39) missense possibly damaging 0.89
R5985:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R5986:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6053:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6072:Plekha6 UTSW 1 133,200,045 (GRCm39) missense possibly damaging 0.94
R6167:Plekha6 UTSW 1 133,207,145 (GRCm39) missense probably null 0.96
R6843:Plekha6 UTSW 1 133,202,616 (GRCm39) missense probably damaging 1.00
R6879:Plekha6 UTSW 1 133,187,793 (GRCm39) missense possibly damaging 0.95
R6912:Plekha6 UTSW 1 133,200,273 (GRCm39) missense probably benign 0.02
R6970:Plekha6 UTSW 1 133,191,556 (GRCm39) missense probably benign 0.43
R7041:Plekha6 UTSW 1 133,200,198 (GRCm39) missense possibly damaging 0.93
R7248:Plekha6 UTSW 1 133,203,586 (GRCm39) nonsense probably null
R7400:Plekha6 UTSW 1 133,201,762 (GRCm39) nonsense probably null
R7720:Plekha6 UTSW 1 133,221,445 (GRCm39) missense probably damaging 1.00
R7772:Plekha6 UTSW 1 133,097,760 (GRCm39) missense possibly damaging 0.57
R8011:Plekha6 UTSW 1 133,191,544 (GRCm39) missense probably benign
R8301:Plekha6 UTSW 1 133,192,425 (GRCm39) missense probably damaging 0.96
R8387:Plekha6 UTSW 1 133,219,893 (GRCm39) splice site probably null
R8465:Plekha6 UTSW 1 133,197,778 (GRCm39) missense probably damaging 0.98
R8501:Plekha6 UTSW 1 133,215,575 (GRCm39) missense probably benign 0.34
R9025:Plekha6 UTSW 1 133,212,999 (GRCm39) missense probably benign 0.01
R9044:Plekha6 UTSW 1 133,201,688 (GRCm39) missense possibly damaging 0.95
R9044:Plekha6 UTSW 1 133,201,687 (GRCm39) missense probably benign 0.01
R9165:Plekha6 UTSW 1 133,200,375 (GRCm39) missense probably damaging 1.00
R9179:Plekha6 UTSW 1 133,214,085 (GRCm39) missense possibly damaging 0.90
R9186:Plekha6 UTSW 1 133,220,171 (GRCm39) missense probably damaging 1.00
R9188:Plekha6 UTSW 1 133,220,171 (GRCm39) missense probably damaging 1.00
R9321:Plekha6 UTSW 1 133,209,549 (GRCm39) missense probably damaging 0.98
Z1176:Plekha6 UTSW 1 133,200,209 (GRCm39) missense probably damaging 0.98
Z1176:Plekha6 UTSW 1 133,191,551 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGCTGCACACTCAAAG -3'
(R):5'- TAGTGAATGCTCGGTCTGACC -3'

Sequencing Primer
(F):5'- GGCCTCCCCAAGCCAATTG -3'
(R):5'- AATGCTCGGTCTGACCCTATGAAC -3'
Posted On 2015-05-15