Incidental Mutation 'R4067:Mrps2'
ID316145
Institutional Source Beutler Lab
Gene Symbol Mrps2
Ensembl Gene ENSMUSG00000035772
Gene Namemitochondrial ribosomal protein S2
Synonyms
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28468066-28471178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28469770 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 213 (N213S)
Ref Sequence ENSEMBL: ENSMUSP00000036725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
AA Change: N213S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772
AA Change: N213S

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086370
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126242
Predicted Effect probably benign
Transcript: ENSMUST00000127683
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146332
Meta Mutation Damage Score 0.2073 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S2 family. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Mrps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01819:Mrps2 APN 2 28468336 missense probably benign 0.00
IGL02250:Mrps2 APN 2 28469545 missense possibly damaging 0.95
IGL03172:Mrps2 APN 2 28469806 missense probably damaging 0.99
R0090:Mrps2 UTSW 2 28468256 missense probably damaging 0.99
R0325:Mrps2 UTSW 2 28469779 missense probably damaging 1.00
R1437:Mrps2 UTSW 2 28468887 missense probably damaging 1.00
R1511:Mrps2 UTSW 2 28469664 missense probably damaging 0.96
R1589:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R1590:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R1591:Mrps2 UTSW 2 28469488 missense probably benign 0.06
R2098:Mrps2 UTSW 2 28468315 missense probably benign 0.04
R4376:Mrps2 UTSW 2 28468859 missense probably benign 0.00
R4541:Mrps2 UTSW 2 28468400 unclassified probably benign
R4761:Mrps2 UTSW 2 28469934 missense probably benign 0.00
R5207:Mrps2 UTSW 2 28469751 missense probably damaging 0.99
R7109:Mrps2 UTSW 2 28468246 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATTGAGACTACAGCCCAGGC -3'
(R):5'- CTTATCAGGCACAGGAGATGTC -3'

Sequencing Primer
(F):5'- ACTACAGCCCAGGCCTGTG -3'
(R):5'- ACAGGAGATGTCCCACTGC -3'
Posted On2015-05-15