Incidental Mutation 'R4067:Kirrel'
ID316151
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Namekirre like nephrin family adhesion molecule 1
SynonymsKirrel1, 6720469N11Rik, Neph1
MMRRC Submission 040853-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87078593-87174747 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 87088467 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 387 (Q387*)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: Q387*
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: Q387*

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1876:Kirrel UTSW 3 87089151 missense probably null 0.46
R1995:Kirrel UTSW 3 87095786 missense possibly damaging 0.88
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3911:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4198:Kirrel UTSW 3 87089151 missense probably null 0.46
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4460:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
R7199:Kirrel UTSW 3 87083388 missense probably benign 0.02
R7221:Kirrel UTSW 3 87086397 nonsense probably null
R7284:Kirrel UTSW 3 87083387 missense probably benign 0.02
R7332:Kirrel UTSW 3 87088398 missense probably benign 0.14
R7369:Kirrel UTSW 3 87141084 missense probably benign 0.20
R7371:Kirrel UTSW 3 87088422 missense probably benign 0.44
R7508:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R7566:Kirrel UTSW 3 87088484 missense probably damaging 1.00
R7567:Kirrel UTSW 3 87095681 missense probably damaging 0.99
R7621:Kirrel UTSW 3 87088221 missense possibly damaging 0.70
R8030:Kirrel UTSW 3 87097775 missense probably damaging 1.00
Z1177:Kirrel UTSW 3 87083875 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATAGGCAGGAAGACCCAGTC -3'
(R):5'- TTATTGCCAGCCTGCTTAGAGTC -3'

Sequencing Primer
(F):5'- TCAGGCCGGTCAGATCTCAG -3'
(R):5'- CCAGCCTGCTTAGAGTCTTAGG -3'
Posted On2015-05-15