Mutagenetix > Incidental Mutation

Incidental Mutation 'R4067:Col9a2'

316157

Institutional Source

Beutler Lab

Gene Symbol

Col9a2

Ensembl Gene

ENSMUSG00000028626

Gene Name

collagen, type IX, alpha 2

Synonyms

Col9a-2

MMRRC Submission

040853-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4067 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121039385-121055322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121052389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 415 (I415N)

Ref Sequence

ENSEMBL: ENSMUSP00000030372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030372]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030372
AA Change: I415N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030372
Gene: ENSMUSG00000028626
AA Change: I415N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Collagen	24	82	7.3e-12	PFAM
Pfam:Collagen	59	115	2.4e-10	PFAM
Pfam:Collagen	113	170	2e-8	PFAM
Pfam:Collagen	176	236	8.9e-11	PFAM
low complexity region	258	277	N/A	INTRINSIC
low complexity region	288	315	N/A	INTRINSIC
Pfam:Collagen	357	435	4.4e-8	PFAM
Pfam:Collagen	459	523	6.1e-11	PFAM
Pfam:Collagen	548	610	4.5e-11	PFAM
low complexity region	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140119

Meta Mutation Damage Score

0.1735

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. This chain is unusual in that, unlike the other two type IX alpha chains, it contains a covalently attached glycosaminoglycan side chain. Mutations in this gene are associated with multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025G04Rik	T	A	1: 151,893,399	T121S	possibly damaging	Het
4930503E14Rik	T	C	14: 44,169,184	E136G	probably damaging	Het
Adgrg4	A	G	X: 56,959,960	N2527S	probably damaging	Het
Ak1	G	A	2: 32,629,581	S7N	probably benign	Het
Aktip	A	C	8: 91,125,838	I230R	possibly damaging	Het
Alms1	A	G	6: 85,621,289	I1032M	probably damaging	Het
Asb4	T	A	6: 5,423,651	V266E	probably damaging	Het
Bace1	G	A	9: 45,854,664	V130M	probably damaging	Het
BC017643	A	T	11: 121,224,702		probably null	Het
Bglap	A	T	3: 88,384,437		probably benign	Het
Brpf3	T	C	17: 28,821,259	S885P	probably benign	Het
Chd9	A	T	8: 91,023,574	I1742F	possibly damaging	Het
Dnajc7	T	C	11: 100,601,781	Y38C	probably benign	Het
Enam	A	G	5: 88,503,377	Y840C	probably damaging	Het
Etnppl	T	A	3: 130,631,793	C416S	probably damaging	Het
Fgf20	A	T	8: 40,279,855	S181T	probably benign	Het
Fut8	T	A	12: 77,464,061	Y421N	probably damaging	Het
Gcn1l1	T	G	5: 115,599,088	L1295R	probably damaging	Het
Gm11437	A	G	11: 84,164,511	V93A	probably benign	Het
Gm1966	T	A	7: 106,599,565		noncoding transcript	Het
Gm597	T	A	1: 28,777,631	D440V	probably damaging	Het
Gm9989	T	C	3: 81,922,242		noncoding transcript	Het
Gsdmc4	A	T	15: 63,893,887		probably null	Het
Ighv10-1	A	T	12: 114,479,023	M114K	probably benign	Het
Iltifb	T	C	10: 118,290,210	I161V	probably damaging	Het
Itfg2	T	A	6: 128,410,450		probably benign	Het
Kirrel	G	A	3: 87,088,467	Q387*	probably null	Het
Klk1	C	T	7: 44,227,544	R24*	probably null	Het
Klra7	T	C	6: 130,231,649		probably null	Het
Ltn1	T	C	16: 87,416,230	Y481C	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mrps2	A	G	2: 28,469,770	N213S	probably benign	Het
Muc4	A	T	16: 32,751,051	I310F	possibly damaging	Het
Ntrk3	T	A	7: 78,517,437	Y102F	probably damaging	Het
Olfr1058	A	T	2: 86,386,087	C110*	probably null	Het
Otof	C	T	5: 30,399,291	G282D	probably damaging	Het
Pcdhb2	A	T	18: 37,297,314		probably null	Het
Pign	A	T	1: 105,587,978		probably null	Het
Plekha6	G	A	1: 133,294,678	E1001K	probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Ppm1d	A	G	11: 85,345,852	T486A	probably benign	Het
Pudp	A	G	18: 50,568,258	F135L	probably benign	Het
Rd3l	T	G	12: 111,979,511	N178T	probably benign	Het
Rel	A	C	11: 23,753,215		probably null	Het
Sf3a1	T	A	11: 4,167,824	F195L	probably damaging	Het
Slc30a1	G	C	1: 191,907,289	A95P	probably damaging	Het
Slc47a2	T	C	11: 61,303,947	T469A	probably benign	Het
Slc4a10	A	T	2: 62,046,645	M1L	probably benign	Het
Slc8a1	T	A	17: 81,648,274	D445V	probably damaging	Het
Slc9a7	C	T	X: 20,205,554	G113R	probably damaging	Het
Spic	T	C	10: 88,675,683	H237R	possibly damaging	Het
Stk26	A	G	X: 50,889,033	E317G	probably benign	Het
Tex10	A	T	4: 48,459,355	Y506*	probably null	Het
Trhde	T	A	10: 114,444,680	R848*	probably null	Het
Trpc5	T	A	X: 144,419,598	R545*	probably null	Het
Usp24	C	T	4: 106,359,089	T379M	possibly damaging	Het
Wdr34	A	G	2: 30,032,808	L309P	probably benign	Het
Zfp783	A	T	6: 47,945,565		noncoding transcript	Het

Other mutations in Col9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01331:Col9a2	APN	4	121045192	missense	possibly damaging	0.95
IGL01978:Col9a2	APN	4	121044666	missense	unknown
IGL01995:Col9a2	APN	4	121050410	critical splice donor site	probably null
IGL02162:Col9a2	APN	4	121054334	unclassified	probably benign
IGL02931:Col9a2	APN	4	121053192	missense	probably benign	0.06
collision	UTSW	4	121049716	critical splice donor site	probably null
gravity_wave	UTSW	4	121044019	critical splice donor site	probably null
R0208:Col9a2	UTSW	4	121052288	splice site	probably benign
R0426:Col9a2	UTSW	4	121044660	splice site	probably benign
R0512:Col9a2	UTSW	4	121054307	missense	probably benign	0.22
R0973:Col9a2	UTSW	4	121039788	critical splice donor site	probably null
R1023:Col9a2	UTSW	4	121044010	missense	unknown
R1657:Col9a2	UTSW	4	121040974	missense	unknown
R1724:Col9a2	UTSW	4	121053902	missense	probably damaging	1.00
R2171:Col9a2	UTSW	4	121045001	nonsense	probably null
R2206:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2221:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2223:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2273:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2274:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2275:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2354:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2392:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2393:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R2394:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3421:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3426:Col9a2	UTSW	4	121050407	missense	possibly damaging	0.93
R3710:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3821:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3838:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R3839:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4298:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4299:Col9a2	UTSW	4	121054258	missense	probably damaging	0.98
R4595:Col9a2	UTSW	4	121045155	missense	probably benign	0.04
R4942:Col9a2	UTSW	4	121053119	missense	possibly damaging	0.73
R5120:Col9a2	UTSW	4	121039772	missense	unknown
R5434:Col9a2	UTSW	4	121040965	nonsense	probably null
R6143:Col9a2	UTSW	4	121053863	missense	probably damaging	0.99
R7027:Col9a2	UTSW	4	121044019	critical splice donor site	probably null
R7056:Col9a2	UTSW	4	121049716	critical splice donor site	probably null
R7417:Col9a2	UTSW	4	121054292	missense	not run
R7571:Col9a2	UTSW	4	121039784	missense	unknown
R9120:Col9a2	UTSW	4	121043754	splice site	probably benign
R9341:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9343:Col9a2	UTSW	4	121054286	missense	probably benign	0.03
R9389:Col9a2	UTSW	4	121054751	missense	probably benign	0.00
R9527:Col9a2	UTSW	4	121042331	critical splice donor site	probably null
R9620:Col9a2	UTSW	4	121053206	critical splice donor site	probably null
R9784:Col9a2	UTSW	4	121041029	missense	unknown
Z1176:Col9a2	UTSW	4	121053797	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCCGCCTCATGTAAAAGG -3'
(R):5'- TGTCGTGAAATGTCCTTTCCAAG -3'

Sequencing Primer
(F):5'- TCATGTAAAAGGCTGGCCCTG -3'
(R):5'- ATGTCCTTTCCAAGAAGGGAGCTC -3'

Posted On

2015-05-15