Incidental Mutation 'R4067:Asb4'
ID316164
Institutional Source Beutler Lab
Gene Symbol Asb4
Ensembl Gene ENSMUSG00000042607
Gene Nameankyrin repeat and SOCS box-containing 4
Synonyms
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location5383386-5433022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5423651 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 266 (V266E)
Ref Sequence ENSEMBL: ENSMUSP00000040331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043294]
Predicted Effect probably damaging
Transcript: ENSMUST00000043294
AA Change: V266E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040331
Gene: ENSMUSG00000042607
AA Change: V266E

DomainStartEndE-ValueType
ANK 74 103 6.26e-2 SMART
ANK 106 135 4.46e-7 SMART
ANK 139 168 4.86e1 SMART
ANK 174 203 2.43e1 SMART
ANK 207 247 1.17e2 SMART
ANK 251 280 8.86e-2 SMART
SOCS_box 381 420 7.48e-10 SMART
Meta Mutation Damage Score 0.1151 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Multiple alternatively spliced transcript variants have been described for this gene but some of the full length sequences are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired placentation, embryonic growth arrest, reduced litter size, and pre-eclampsia like features including hypertension and albuminuria in late-stage pregnant females as well as renal defects including glomerular endotheliosis and mesangial expansion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Asb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02086:Asb4 APN 6 5398386 missense probably benign 0.00
IGL03015:Asb4 APN 6 5398515 missense possibly damaging 0.75
IGL03280:Asb4 APN 6 5423416 missense probably benign
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1146:Asb4 UTSW 6 5423591 missense probably damaging 0.99
R1267:Asb4 UTSW 6 5423747 missense probably damaging 1.00
R1435:Asb4 UTSW 6 5398410 missense probably benign 0.33
R1595:Asb4 UTSW 6 5390692 missense probably damaging 1.00
R1764:Asb4 UTSW 6 5390798 splice site probably null
R2118:Asb4 UTSW 6 5390687 missense probably benign
R3976:Asb4 UTSW 6 5390771 missense probably benign 0.01
R4020:Asb4 UTSW 6 5390803 splice site probably benign
R4469:Asb4 UTSW 6 5423409 missense probably benign 0.01
R4895:Asb4 UTSW 6 5398266 missense probably damaging 0.98
R5432:Asb4 UTSW 6 5430912 missense probably damaging 1.00
R5444:Asb4 UTSW 6 5431040 missense probably damaging 0.98
R6196:Asb4 UTSW 6 5390699 missense probably benign 0.05
R6276:Asb4 UTSW 6 5431043 missense probably damaging 1.00
R6333:Asb4 UTSW 6 5423597 missense probably damaging 1.00
R6922:Asb4 UTSW 6 5398304 missense possibly damaging 0.87
R7098:Asb4 UTSW 6 5398499 missense probably damaging 1.00
R7196:Asb4 UTSW 6 5423356 missense probably benign 0.00
R7547:Asb4 UTSW 6 5398350 missense probably damaging 1.00
R7561:Asb4 UTSW 6 5430968 missense possibly damaging 0.87
R7707:Asb4 UTSW 6 5430968 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGCCTTCTACGTGGAGAAC -3'
(R):5'- TCACCTTGTGGAACTGTGGG -3'

Sequencing Primer
(F):5'- CATCGTGGATAGCATGAACGCC -3'
(R):5'- GGGGTAGATGCGCGCAG -3'
Posted On2015-05-15