Incidental Mutation 'R4067:Itfg2'
ID316167
Institutional Source Beutler Lab
Gene Symbol Itfg2
Ensembl Gene ENSMUSG00000001518
Gene Nameintegrin alpha FG-GAP repeat containing 2
Synonyms
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128409444-128424931 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 128410450 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001559] [ENSMUST00000001561] [ENSMUST00000120405] [ENSMUST00000123867] [ENSMUST00000142615] [ENSMUST00000203026] [ENSMUST00000203374] [ENSMUST00000203853] [ENSMUST00000204223] [ENSMUST00000204836]
Predicted Effect probably benign
Transcript: ENSMUST00000001559
SMART Domains Protein: ENSMUSP00000001559
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 382 1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001561
SMART Domains Protein: ENSMUSP00000001561
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 88 203 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120405
SMART Domains Protein: ENSMUSP00000113317
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 88 202 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123867
SMART Domains Protein: ENSMUSP00000122558
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 105 218 4.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136631
Predicted Effect probably benign
Transcript: ENSMUST00000142615
SMART Domains Protein: ENSMUSP00000145111
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 358 1e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147155
SMART Domains Protein: ENSMUSP00000122305
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203026
SMART Domains Protein: ENSMUSP00000145388
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 130 3.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203195
Predicted Effect probably benign
Transcript: ENSMUST00000203374
SMART Domains Protein: ENSMUSP00000145323
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 21 350 1.3e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203853
SMART Domains Protein: ENSMUSP00000145282
Gene: ENSMUSG00000001518

DomainStartEndE-ValueType
Pfam:Itfg2 49 85 3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203984
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204362
Predicted Effect probably benign
Transcript: ENSMUST00000204836
SMART Domains Protein: ENSMUSP00000144750
Gene: ENSMUSG00000001520

DomainStartEndE-ValueType
Pfam:Asp_protease 28 141 8.9e-6 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal B cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Itfg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Itfg2 APN 6 128411606 missense probably benign 0.02
IGL02111:Itfg2 APN 6 128410381 missense probably benign 0.01
IGL02337:Itfg2 APN 6 128413570 missense probably benign 0.02
IGL02611:Itfg2 APN 6 128424725 missense probably damaging 1.00
R0492:Itfg2 UTSW 6 128413523 critical splice donor site probably null
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R1462:Itfg2 UTSW 6 128424728 missense probably damaging 1.00
R2960:Itfg2 UTSW 6 128413552 missense probably benign 0.33
R3110:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R3112:Itfg2 UTSW 6 128411669 missense probably damaging 1.00
R4866:Itfg2 UTSW 6 128416316 intron probably benign
R4900:Itfg2 UTSW 6 128416316 intron probably benign
R6623:Itfg2 UTSW 6 128411657 missense probably damaging 1.00
R6979:Itfg2 UTSW 6 128411591 missense probably damaging 1.00
R7031:Itfg2 UTSW 6 128416054 missense probably damaging 0.99
R7162:Itfg2 UTSW 6 128410583 missense probably damaging 0.98
R7660:Itfg2 UTSW 6 128424746 missense probably damaging 0.99
R7884:Itfg2 UTSW 6 128416381 intron probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTCATGGATCGCTCTGG -3'
(R):5'- CAACAGTCCCTGCTTGGTATATG -3'

Sequencing Primer
(F):5'- CATGGATCGCTCTGGGGTAG -3'
(R):5'- GCTTGGTATATGTCACCTTCAATCAG -3'
Posted On2015-05-15