Incidental Mutation 'R4067:Klk1'
ID316168
Institutional Source Beutler Lab
Gene Symbol Klk1
Ensembl Gene ENSMUSG00000063903
Gene Namekallikrein 1
SynonymsKlk6, mGk-6
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44225360-44229618 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 44227544 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 24 (R24*)
Ref Sequence ENSEMBL: ENSMUSP00000074659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037220] [ENSMUST00000075162] [ENSMUST00000206144] [ENSMUST00000206366] [ENSMUST00000206686]
Predicted Effect probably benign
Transcript: ENSMUST00000037220
SMART Domains Protein: ENSMUSP00000048665
Gene: ENSMUSG00000038782

DomainStartEndE-ValueType
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072123
SMART Domains Protein: ENSMUSP00000071992
Gene: ENSMUSG00000062073

DomainStartEndE-ValueType
transmembrane domain 32 49 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075162
AA Change: R24*
SMART Domains Protein: ENSMUSP00000074659
Gene: ENSMUSG00000063903
AA Change: R24*

DomainStartEndE-ValueType
Tryp_SPc 24 253 7.26e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205329
Predicted Effect probably benign
Transcript: ENSMUST00000206144
Predicted Effect probably benign
Transcript: ENSMUST00000206366
Predicted Effect probably benign
Transcript: ENSMUST00000206686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206890
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. Mice lacking the encoded protein are unable to generate significant levels of kinins in most tissues, develop cardiovascular abnormalities and exhibit hypercalciuria of renal origin. This gene is located in a cluster of several related kallikrein genes on chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Klk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Klk1 APN 7 44228596 missense probably damaging 0.98
IGL01788:Klk1 APN 7 44228983 missense probably benign 0.00
R0011:Klk1 UTSW 7 44229535 missense probably benign 0.03
R0184:Klk1 UTSW 7 44228749 missense possibly damaging 0.50
R0853:Klk1 UTSW 7 44221498 unclassified probably benign
R0925:Klk1 UTSW 7 44228816 critical splice donor site probably null
R2044:Klk1 UTSW 7 44229034 missense possibly damaging 0.95
R2518:Klk1 UTSW 7 44220737 unclassified probably null
R2982:Klk1 UTSW 7 44229439 missense probably damaging 1.00
R3962:Klk1 UTSW 7 44229549 missense possibly damaging 0.87
R4041:Klk1 UTSW 7 44229562 missense probably damaging 1.00
R4385:Klk1 UTSW 7 44228569 missense probably benign 0.12
R4901:Klk1 UTSW 7 44228715 missense probably damaging 0.99
R5256:Klk1 UTSW 7 44221561 unclassified probably benign
R5580:Klk1 UTSW 7 44228814 missense probably benign 0.00
R5595:Klk1 UTSW 7 44228737 unclassified probably null
R6818:Klk1 UTSW 7 44229459 missense probably damaging 1.00
R7100:Klk1 UTSW 7 44229424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGTCTTGCTTCAAAAGTTC -3'
(R):5'- AGTCATGTTCTCTGGCTGCC -3'

Sequencing Primer
(F):5'- ACAGCATAGATCTCCCTATCCAGG -3'
(R):5'- CTCTGGCTGCCACCCTG -3'
Posted On2015-05-15