Incidental Mutation 'R4067:Fgf20'
ID316171
Institutional Source Beutler Lab
Gene Symbol Fgf20
Ensembl Gene ENSMUSG00000031603
Gene Namefibroblast growth factor 20
Synonyms
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40279166-40308331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40279855 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 181 (S181T)
Ref Sequence ENSEMBL: ENSMUSP00000034014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034014] [ENSMUST00000118639]
Predicted Effect probably benign
Transcript: ENSMUST00000034014
AA Change: S181T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034014
Gene: ENSMUSG00000031603
AA Change: S181T

DomainStartEndE-ValueType
low complexity region 35 53 N/A INTRINSIC
FGF 63 194 3.3e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118639
AA Change: S127T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112756
Gene: ENSMUSG00000031603
AA Change: S127T

DomainStartEndE-ValueType
FGF 6 140 2.08e-47 SMART
Meta Mutation Damage Score 0.0949 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor family. The fibroblast growth factors possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene product is a secreted neurotrophic factor but lacks a typical signal peptide. It is expressed in normal brain, particularly the cerebellum, and may regulate central nervous system development and function. Homodimerization of this protein was shown to regulate its receptor binding activity and concentration gradient in the extracellular matrix. Genetic variations of this gene have been associated with Parkinson disease susceptibility. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired coclear lateral compartment differentiation and deafness without loss of vestibular function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Fgf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02730:Fgf20 APN 8 40279787 missense probably damaging 0.99
IGL03365:Fgf20 APN 8 40279891 missense possibly damaging 0.95
mermaid UTSW 8 40281148 missense probably damaging 0.98
LCD18:Fgf20 UTSW 8 40292318 intron probably benign
R1893:Fgf20 UTSW 8 40279803 missense possibly damaging 0.49
R4613:Fgf20 UTSW 8 40286611 missense probably benign
R6166:Fgf20 UTSW 8 40279840 missense probably damaging 0.98
R6280:Fgf20 UTSW 8 40281112 nonsense probably null
R6869:Fgf20 UTSW 8 40281148 missense probably damaging 0.98
R7561:Fgf20 UTSW 8 40279934 missense possibly damaging 0.92
R7739:Fgf20 UTSW 8 40279896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCGTAATATCCTGAACGTC -3'
(R):5'- AGAGTTGAGGCTTTTGTAAGGAAC -3'

Sequencing Primer
(F):5'- GTAATATCCTGAACGTCTTCTTCGG -3'
(R):5'- GAATGCATCTTCAGGGAAC -3'
Posted On2015-05-15