Incidental Mutation 'R4067:Aktip'
ID316173
Institutional Source Beutler Lab
Gene Symbol Aktip
Ensembl Gene ENSMUSG00000031667
Gene Namethymoma viral proto-oncogene 1 interacting protein
SynonymsFt1
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location91111784-91199976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 91125838 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 230 (I230R)
Ref Sequence ENSEMBL: ENSMUSP00000113379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034091] [ENSMUST00000109609] [ENSMUST00000120213] [ENSMUST00000120349] [ENSMUST00000120426] [ENSMUST00000125257] [ENSMUST00000209311] [ENSMUST00000209444] [ENSMUST00000209518] [ENSMUST00000211136]
Predicted Effect probably benign
Transcript: ENSMUST00000034091
SMART Domains Protein: ENSMUSP00000034091
Gene: ENSMUSG00000031666

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CYCLIN 44 131 5.81e-1 SMART
DUF3452 94 236 2.36e-77 SMART
low complexity region 301 313 N/A INTRINSIC
RB_A 414 606 3.42e-106 SMART
low complexity region 722 733 N/A INTRINSIC
low complexity region 758 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
CYCLIN 845 1008 2.86e-6 SMART
Rb_C 1019 1135 5.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109609
AA Change: I230R

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105238
Gene: ENSMUSG00000031667
AA Change: I230R

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120213
AA Change: I230R

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112375
Gene: ENSMUSG00000031667
AA Change: I230R

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120349
AA Change: I230R

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113769
Gene: ENSMUSG00000031667
AA Change: I230R

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120426
AA Change: I230R

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113379
Gene: ENSMUSG00000031667
AA Change: I230R

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125257
AA Change: I230R

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119277
Gene: ENSMUSG00000031667
AA Change: I230R

DomainStartEndE-ValueType
UBCc 77 222 3.97e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209311
Predicted Effect probably benign
Transcript: ENSMUST00000209444
Predicted Effect probably benign
Transcript: ENSMUST00000209518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211042
Predicted Effect probably benign
Transcript: ENSMUST00000211050
Predicted Effect probably benign
Transcript: ENSMUST00000211136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211618
Meta Mutation Damage Score 0.1549 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mouse homolog of this gene produces fused toes and thymic hyperplasia in heterozygous mutant animals while homozygous mutants die in early development. This gene may play a role in apoptosis as these morphological abnormalities are caused by altered patterns of programmed cell death. The protein encoded by this gene is similar to the ubiquitin ligase domain of other ubiquitin-conjugating enzymes but lacks the conserved cysteine residue that enables those enzymes to conjugate ubiquitin to the target protein. This protein interacts directly with serine/threonine kinase protein kinase B (PKB)/Akt and modulates PKB activity by enhancing the phosphorylation of PKB's regulatory sites. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Aktip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Aktip APN 8 91126225 missense probably damaging 1.00
IGL02351:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL02358:Aktip APN 8 91126892 missense possibly damaging 0.73
IGL03085:Aktip APN 8 91126023 critical splice donor site probably null
R1564:Aktip UTSW 8 91131081 start codon destroyed probably null 0.94
R1809:Aktip UTSW 8 91129720 missense probably damaging 1.00
R1851:Aktip UTSW 8 91125877 missense possibly damaging 0.93
R4455:Aktip UTSW 8 91124851 missense probably benign 0.00
R5052:Aktip UTSW 8 91129651 missense possibly damaging 0.47
R5330:Aktip UTSW 8 91126724 missense probably damaging 0.98
R6134:Aktip UTSW 8 91129760 missense probably damaging 1.00
R6178:Aktip UTSW 8 91126043 missense probably damaging 0.98
R6984:Aktip UTSW 8 91126718 missense probably damaging 1.00
R7672:Aktip UTSW 8 91129657 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCCTCTGGTTTAAGGCTAAGAG -3'
(R):5'- TCTACAAGATCGACACGACGAG -3'

Sequencing Primer
(F):5'- GCTAAGAGCCTGAGCGG -3'
(R):5'- GCAGTGCTGTATGTGACCCTTAC -3'
Posted On2015-05-15