Incidental Mutation 'R4067:Rel'
ID316178
Institutional Source Beutler Lab
Gene Symbol Rel
Ensembl Gene ENSMUSG00000020275
Gene Namereticuloendotheliosis oncogene
Synonymsc-Rel
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23736847-23770970 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 23753215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102864]
Predicted Effect probably null
Transcript: ENSMUST00000102864
SMART Domains Protein: ENSMUSP00000099928
Gene: ENSMUSG00000020275

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 10 178 8.1e-78 PFAM
IPT 185 280 7.64e-24 SMART
low complexity region 512 530 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rel homology domain/immunoglobulin-like fold, plexin, transcription factor (RHD/IPT) family. Members of this family regulate genes involved in apoptosis, inflammation, the immune response, and oncogenic processes. This proto-oncogene plays a role in the survival and proliferation of B lymphocytes. Mutation or amplification of this gene is associated with B-cell lymphomas, including Hodgkin's lymphoma. Single nucleotide polymorphisms in this gene are associated with susceptibility to ulcerative colitis and rheumatoid arthritis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous inactivation of this gene causes defects in lymphocyte proliferation, humoral immunity and cytokine production, and may lead to impaired Th1 responses and resistance to autoimmune disease. Mice lacking only the COOH-terminal region show severehemopoietic defects and lymphoid hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Rel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Rel APN 11 23757043 missense probably benign 0.31
IGL00819:Rel APN 11 23743029 missense probably benign 0.13
IGL00906:Rel APN 11 23744266 missense probably benign 0.00
IGL01358:Rel APN 11 23761155 missense probably benign 0.06
IGL01820:Rel APN 11 23753218 missense probably benign 0.22
IGL01889:Rel APN 11 23757035 missense probably damaging 0.96
IGL03270:Rel APN 11 23742584 missense probably benign 0.16
Amun-ra UTSW 11 23757026 nonsense probably null
Fleur UTSW 11 unclassified
giza UTSW 11 23757010 missense probably damaging 1.00
Horus UTSW 11 23753215 critical splice donor site probably null
osirus UTSW 11 23742713 missense probably benign 0.00
R0766:Rel UTSW 11 23757010 missense probably damaging 1.00
R0924:Rel UTSW 11 23742439 missense probably benign 0.02
R0930:Rel UTSW 11 23742439 missense probably benign 0.02
R1312:Rel UTSW 11 23757010 missense probably damaging 1.00
R1339:Rel UTSW 11 23745763 missense probably damaging 1.00
R1584:Rel UTSW 11 23745546 missense probably damaging 1.00
R1980:Rel UTSW 11 23742761 missense probably benign
R1981:Rel UTSW 11 23742761 missense probably benign
R1982:Rel UTSW 11 23742761 missense probably benign
R2513:Rel UTSW 11 23745823 missense probably damaging 1.00
R2870:Rel UTSW 11 23761129 missense probably benign
R2870:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2871:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R2872:Rel UTSW 11 23761129 missense probably benign
R3617:Rel UTSW 11 23745780 missense probably damaging 1.00
R3976:Rel UTSW 11 23742939 missense probably benign 0.07
R4010:Rel UTSW 11 23761138 missense probably benign
R5345:Rel UTSW 11 23742462 missense probably benign 0.00
R5866:Rel UTSW 11 23742724 nonsense probably null
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6032:Rel UTSW 11 23742684 missense probably benign 0.02
R6562:Rel UTSW 11 23757026 nonsense probably null
R6886:Rel UTSW 11 23744304 missense probably benign 0.03
R7516:Rel UTSW 11 23742785 missense probably benign 0.00
R7522:Rel UTSW 11 23770676 splice site probably null
R7663:Rel UTSW 11 23742713 missense probably benign 0.00
R7873:Rel UTSW 11 23742957 missense probably benign 0.00
R7956:Rel UTSW 11 23742957 missense probably benign 0.00
Z1176:Rel UTSW 11 23745472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTTGGAGAAGGTTTCAGTTTTG -3'
(R):5'- AGAGAGCTGACTTTCTGAGTATG -3'

Sequencing Primer
(F):5'- AGTTCATGGCCAATCTGGAGTAC -3'
(R):5'- GGGTATTCGGTGTGTAAAGAA -3'
Posted On2015-05-15