Mutagenetix > Incidental Mutation

Incidental Mutation 'R4067:Ppm1d'

316181

Institutional Source

Beutler Lab

Gene Symbol

Ppm1d

Ensembl Gene

ENSMUSG00000020525

Gene Name

protein phosphatase 1D magnesium-dependent, delta isoform

Synonyms

Wip1

MMRRC Submission

040853-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4067 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85311244-85347066 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85345852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 486 (T486A)

Ref Sequence

ENSEMBL: ENSMUSP00000020835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020835]

AlphaFold

Q9QZ67

Predicted Effect

probably benign
Transcript: ENSMUST00000020835
AA Change: T486A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000020835
Gene: ENSMUSG00000020525
AA Change: T486A

Domain	Start	End	E-Value	Type
PP2Cc	1	366	1.4e-76	SMART
PP2C_SIG	78	368	6.09e0	SMART
low complexity region	403	415	N/A	INTRINSIC
Blast:PP2Cc	416	476	1e-19	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. The expression of this gene is induced in a p53-dependent manner in response to various environmental stresses. While being induced by tumor suppressor protein TP53/p53, this phosphatase negatively regulates the activity of p38 MAP kinase, MAPK/p38, through which it reduces the phosphorylation of p53, and in turn suppresses p53-mediated transcription and apoptosis. This phosphatase thus mediates a feedback regulation of p38-p53 signaling that contributes to growth inhibition and the suppression of stress induced apoptosis. This gene is located in a chromosomal region known to be amplified in breast cancer. The amplification of this gene has been detected in both breast cancer cell line and primary breast tumors, which suggests a role of this gene in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice show some embryonic lethality. Surviving males have variable abnormalities including runting, reproductive organ atrophy with associated reduced fertility, and reduced life span. Both genders have increased susceptibility to viral infection and reduced lymphocyte function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700025G04Rik	T	A	1: 151,893,399	T121S	possibly damaging	Het
4930503E14Rik	T	C	14: 44,169,184	E136G	probably damaging	Het
Adgrg4	A	G	X: 56,959,960	N2527S	probably damaging	Het
Ak1	G	A	2: 32,629,581	S7N	probably benign	Het
Aktip	A	C	8: 91,125,838	I230R	possibly damaging	Het
Alms1	A	G	6: 85,621,289	I1032M	probably damaging	Het
Asb4	T	A	6: 5,423,651	V266E	probably damaging	Het
Bace1	G	A	9: 45,854,664	V130M	probably damaging	Het
BC017643	A	T	11: 121,224,702		probably null	Het
Bglap	A	T	3: 88,384,437		probably benign	Het
Brpf3	T	C	17: 28,821,259	S885P	probably benign	Het
Chd9	A	T	8: 91,023,574	I1742F	possibly damaging	Het
Col9a2	T	A	4: 121,052,389	I415N	probably damaging	Het
Dnajc7	T	C	11: 100,601,781	Y38C	probably benign	Het
Enam	A	G	5: 88,503,377	Y840C	probably damaging	Het
Etnppl	T	A	3: 130,631,793	C416S	probably damaging	Het
Fgf20	A	T	8: 40,279,855	S181T	probably benign	Het
Fut8	T	A	12: 77,464,061	Y421N	probably damaging	Het
Gcn1l1	T	G	5: 115,599,088	L1295R	probably damaging	Het
Gm11437	A	G	11: 84,164,511	V93A	probably benign	Het
Gm1966	T	A	7: 106,599,565		noncoding transcript	Het
Gm597	T	A	1: 28,777,631	D440V	probably damaging	Het
Gm9989	T	C	3: 81,922,242		noncoding transcript	Het
Gsdmc4	A	T	15: 63,893,887		probably null	Het
Ighv10-1	A	T	12: 114,479,023	M114K	probably benign	Het
Iltifb	T	C	10: 118,290,210	I161V	probably damaging	Het
Itfg2	T	A	6: 128,410,450		probably benign	Het
Kirrel	G	A	3: 87,088,467	Q387*	probably null	Het
Klk1	C	T	7: 44,227,544	R24*	probably null	Het
Klra7	T	C	6: 130,231,649		probably null	Het
Ltn1	T	C	16: 87,416,230	Y481C	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mrps2	A	G	2: 28,469,770	N213S	probably benign	Het
Muc4	A	T	16: 32,751,051	I310F	possibly damaging	Het
Ntrk3	T	A	7: 78,517,437	Y102F	probably damaging	Het
Olfr1058	A	T	2: 86,386,087	C110*	probably null	Het
Otof	C	T	5: 30,399,291	G282D	probably damaging	Het
Pcdhb2	A	T	18: 37,297,314		probably null	Het
Pign	A	T	1: 105,587,978		probably null	Het
Plekha6	G	A	1: 133,294,678	E1001K	probably benign	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Pudp	A	G	18: 50,568,258	F135L	probably benign	Het
Rd3l	T	G	12: 111,979,511	N178T	probably benign	Het
Rel	A	C	11: 23,753,215		probably null	Het
Sf3a1	T	A	11: 4,167,824	F195L	probably damaging	Het
Slc30a1	G	C	1: 191,907,289	A95P	probably damaging	Het
Slc47a2	T	C	11: 61,303,947	T469A	probably benign	Het
Slc4a10	A	T	2: 62,046,645	M1L	probably benign	Het
Slc8a1	T	A	17: 81,648,274	D445V	probably damaging	Het
Slc9a7	C	T	X: 20,205,554	G113R	probably damaging	Het
Spic	T	C	10: 88,675,683	H237R	possibly damaging	Het
Stk26	A	G	X: 50,889,033	E317G	probably benign	Het
Tex10	A	T	4: 48,459,355	Y506*	probably null	Het
Trhde	T	A	10: 114,444,680	R848*	probably null	Het
Trpc5	T	A	X: 144,419,598	R545*	probably null	Het
Usp24	C	T	4: 106,359,089	T379M	possibly damaging	Het
Wdr34	A	G	2: 30,032,808	L309P	probably benign	Het
Zfp783	A	T	6: 47,945,565		noncoding transcript	Het

Other mutations in Ppm1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02095:Ppm1d	APN	11	85327006	missense	probably benign	0.04
IGL02351:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02358:Ppm1d	APN	11	85345715	missense	probably damaging	0.99
IGL02496:Ppm1d	APN	11	85339666	missense	possibly damaging	0.51
IGL02667:Ppm1d	APN	11	85332285	missense	probably damaging	1.00
IGL02885:Ppm1d	APN	11	85326944	missense	possibly damaging	0.52
IGL03085:Ppm1d	APN	11	85337163	missense	probably null	0.80
R0114:Ppm1d	UTSW	11	85326905	missense	probably damaging	1.00
R0606:Ppm1d	UTSW	11	85345877	missense	probably benign	0.27
R1014:Ppm1d	UTSW	11	85337154	missense	probably damaging	0.98
R1548:Ppm1d	UTSW	11	85339605	missense	probably damaging	1.00
R3774:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R3775:Ppm1d	UTSW	11	85337167	missense	probably damaging	1.00
R4025:Ppm1d	UTSW	11	85345757	missense	probably benign	0.09
R4065:Ppm1d	UTSW	11	85345852	missense	probably benign	0.01
R4118:Ppm1d	UTSW	11	85311582	missense	probably benign	0.01
R5169:Ppm1d	UTSW	11	85332370	missense	probably damaging	1.00
R5384:Ppm1d	UTSW	11	85311783	missense	probably damaging	0.98
R5861:Ppm1d	UTSW	11	85311848	missense	possibly damaging	0.70
R5890:Ppm1d	UTSW	11	85326908	missense	probably damaging	1.00
R6394:Ppm1d	UTSW	11	85339672	missense	probably benign
R6992:Ppm1d	UTSW	11	85332352	missense	probably damaging	1.00
R7006:Ppm1d	UTSW	11	85337151	missense	possibly damaging	0.92
R7297:Ppm1d	UTSW	11	85345995	missense	probably damaging	1.00
R7993:Ppm1d	UTSW	11	85326951	missense	probably damaging	1.00
R8099:Ppm1d	UTSW	11	85339666	missense	possibly damaging	0.51
R8697:Ppm1d	UTSW	11	85337160	missense	possibly damaging	0.95
R8738:Ppm1d	UTSW	11	85345906	missense	probably damaging	0.99
R9018:Ppm1d	UTSW	11	85337135	missense	probably damaging	0.98
R9188:Ppm1d	UTSW	11	85345921	missense	possibly damaging	0.93
Z1176:Ppm1d	UTSW	11	85339573	missense	probably benign	0.09
Z1177:Ppm1d	UTSW	11	85326963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGTCACCGGAAGAAGATG -3'
(R):5'- AGCCATTTCGTCGGTGCTTC -3'

Sequencing Primer
(F):5'- GCTGAGCTCTAAGGACCATATACCTG -3'
(R):5'- CTTCTTCATAAGGGGGCCAGAG -3'

Posted On

2015-05-15