Incidental Mutation 'R4067:Ltn1'
ID316189
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4067 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87416230 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 481 (Y481C)
Ref Sequence ENSEMBL: ENSMUSP00000156299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039449
AA Change: Y481C

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: Y481C

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083713
Predicted Effect possibly damaging
Transcript: ENSMUST00000232095
AA Change: Y481C

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
R7691:Ltn1 UTSW 16 87398686 missense probably damaging 0.99
R7702:Ltn1 UTSW 16 87426278 missense probably damaging 1.00
R7761:Ltn1 UTSW 16 87411793 missense probably benign
R8002:Ltn1 UTSW 16 87415947 missense probably benign 0.17
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Z1177:Ltn1 UTSW 16 87402037 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTATATTGATGGCAAACCTGACCTGAG -3'
(R):5'- AGGAGGCTTTATACTGCTTTAACTTTG -3'

Sequencing Primer
(F):5'- GCAAACCTGACCTGAGCAGTTTTC -3'
(R):5'- CAAAGACTCAGGACTGCA -3'
Posted On2015-05-15