Incidental Mutation 'R0390:Cnot10'
Institutional Source Beutler Lab
Gene Symbol Cnot10
Ensembl Gene ENSMUSG00000056167
Gene NameCCR4-NOT transcription complex, subunit 10
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0390 (G1)
Quality Score225
Status Validated
Chromosomal Location114585878-114640184 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 114629150 bp
Amino Acid Change Serine to Stop codon at position 96 (S96*)
Ref Sequence ENSEMBL: ENSMUSP00000148963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070117] [ENSMUST00000213955] [ENSMUST00000215155] [ENSMUST00000216785] [ENSMUST00000217148]
Predicted Effect probably null
Transcript: ENSMUST00000070117
AA Change: S96*
SMART Domains Protein: ENSMUSP00000064840
Gene: ENSMUSG00000056167
AA Change: S96*

Blast:TPR 27 60 2e-10 BLAST
coiled coil region 73 107 N/A INTRINSIC
TPR 110 143 4.32e1 SMART
low complexity region 182 198 N/A INTRINSIC
TPR 293 326 3.37e-2 SMART
TPR 355 388 6.75e1 SMART
low complexity region 496 508 N/A INTRINSIC
TPR 643 676 7.87e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213539
Predicted Effect probably benign
Transcript: ENSMUST00000213955
Predicted Effect probably null
Transcript: ENSMUST00000215155
AA Change: S96*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215701
Predicted Effect probably null
Transcript: ENSMUST00000216785
AA Change: S96*
Predicted Effect probably null
Transcript: ENSMUST00000217148
AA Change: S96*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217296
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Cnot10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Cnot10 APN 9 114631855 missense probably benign 0.19
IGL02004:Cnot10 APN 9 114622930 missense probably damaging 1.00
IGL03297:Cnot10 APN 9 114598716 missense possibly damaging 0.87
R0348:Cnot10 UTSW 9 114598770 missense probably benign 0.10
R1256:Cnot10 UTSW 9 114610681 missense probably damaging 1.00
R1471:Cnot10 UTSW 9 114591551 missense probably benign 0.00
R1607:Cnot10 UTSW 9 114629095 nonsense probably null
R1721:Cnot10 UTSW 9 114614999 missense probably benign
R1741:Cnot10 UTSW 9 114597824 missense possibly damaging 0.87
R2116:Cnot10 UTSW 9 114626436 missense probably damaging 1.00
R4073:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4074:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4075:Cnot10 UTSW 9 114622947 missense possibly damaging 0.91
R4365:Cnot10 UTSW 9 114631881 nonsense probably null
R4383:Cnot10 UTSW 9 114631881 nonsense probably null
R4385:Cnot10 UTSW 9 114631881 nonsense probably null
R4398:Cnot10 UTSW 9 114631881 nonsense probably null
R4423:Cnot10 UTSW 9 114617920 missense probably damaging 1.00
R4859:Cnot10 UTSW 9 114627464 missense probably damaging 1.00
R4916:Cnot10 UTSW 9 114629134 missense possibly damaging 0.72
R4927:Cnot10 UTSW 9 114617944 missense probably damaging 1.00
R5153:Cnot10 UTSW 9 114613735 missense probably damaging 1.00
R5677:Cnot10 UTSW 9 114629093 missense probably damaging 1.00
R5702:Cnot10 UTSW 9 114629010 missense probably damaging 0.98
R5790:Cnot10 UTSW 9 114625917 splice site probably null
R6190:Cnot10 UTSW 9 114632723 missense probably damaging 1.00
R6353:Cnot10 UTSW 9 114597546 missense probably damaging 1.00
R6463:Cnot10 UTSW 9 114625902 missense probably damaging 1.00
R6819:Cnot10 UTSW 9 114615055 missense probably benign 0.10
R6849:Cnot10 UTSW 9 114631936 missense probably benign 0.01
R6875:Cnot10 UTSW 9 114615107 missense probably benign 0.00
R7071:Cnot10 UTSW 9 114617719 intron probably null
R7408:Cnot10 UTSW 9 114631826 missense probably benign 0.33
R7412:Cnot10 UTSW 9 114625903 missense probably damaging 1.00
R7645:Cnot10 UTSW 9 114613637 missense probably benign
R7706:Cnot10 UTSW 9 114593438 missense probably damaging 0.98
X0062:Cnot10 UTSW 9 114615134 intron probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tcttaccatctctccagtccc -3'
(R):5'- gcacacatctgcacccac -3'
Posted On2013-04-24