Incidental Mutation 'R4067:Slc9a7'
ID316194
Institutional Source Beutler Lab
Gene Symbol Slc9a7
Ensembl Gene ENSMUSG00000037341
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 7
SynonymsA530087D17Rik, NHE7
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4067 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location20105754-20291807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20205554 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 113 (G113R)
Ref Sequence ENSEMBL: ENSMUSP00000111051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072451] [ENSMUST00000115393]
Predicted Effect probably damaging
Transcript: ENSMUST00000072451
AA Change: G113R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072274
Gene: ENSMUSG00000037341
AA Change: G113R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 77 535 2e-94 PFAM
low complexity region 563 573 N/A INTRINSIC
low complexity region 676 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115393
AA Change: G113R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111051
Gene: ENSMUSG00000037341
AA Change: G113R

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 77 535 8.6e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151845
Meta Mutation Damage Score 0.9339 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium and potassium/ proton antiporter that is a member of the solute carrier family 9 protein family. The encoded protein is primarily localized to the trans-Golgi network and is involved in maintaining pH homeostasis in organelles along the secretory and endocytic pathways. This protein may enhance cell growth of certain breast tumors. This gene is part of a gene cluster on chromosome Xp11.23. A pseudogene of this gene is found on chromosome 12. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Slc9a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc9a7 APN X 20138919 missense probably damaging 1.00
IGL00743:Slc9a7 APN X 20106021 missense possibly damaging 0.81
IGL02377:Slc9a7 APN X 20202724 missense probably damaging 1.00
IGL02960:Slc9a7 APN X 20186143 missense probably benign 0.17
IGL03029:Slc9a7 APN X 20291369 missense probably benign 0.00
R0539:Slc9a7 UTSW X 20202762 missense probably damaging 1.00
R0648:Slc9a7 UTSW X 20162420 unclassified probably benign
R1750:Slc9a7 UTSW X 20162478 missense probably damaging 0.97
R3891:Slc9a7 UTSW X 20186113 missense probably damaging 0.99
X0018:Slc9a7 UTSW X 20291640 missense probably benign
Z1176:Slc9a7 UTSW X 20186059 critical splice donor site probably null
Z1176:Slc9a7 UTSW X 20291739 start gained probably benign
Z1177:Slc9a7 UTSW X 20291588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTATCAGCTCACCTTCCG -3'
(R):5'- ACCAGAGAAAGCATACTTAGGCTC -3'

Sequencing Primer
(F):5'- CGCAGCATGTCATTCTGC -3'
(R):5'- CTCTGGCCAGTTTCTGAAAGAGAC -3'
Posted On2015-05-15