Incidental Mutation 'R4067:Stk26'
ID316195
Institutional Source Beutler Lab
Gene Symbol Stk26
Ensembl Gene ENSMUSG00000031112
Gene Nameserine/threonine kinase 26
SynonymsMst4, 2610018G03Rik
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4067 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location50841047-50893097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50889033 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 317 (E317G)
Ref Sequence ENSEMBL: ENSMUSP00000033444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033444] [ENSMUST00000114887]
Predicted Effect probably benign
Transcript: ENSMUST00000033444
AA Change: E317G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033444
Gene: ENSMUSG00000031112
AA Change: E317G

DomainStartEndE-ValueType
S_TKc 24 274 1.07e-96 SMART
low complexity region 300 318 N/A INTRINSIC
PDB:4GEH|D 325 413 2e-54 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114887
AA Change: E317G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110537
Gene: ENSMUSG00000031112
AA Change: E317G

DomainStartEndE-ValueType
S_TKc 24 274 1.07e-96 SMART
low complexity region 300 318 N/A INTRINSIC
PDB:4GEH|D 325 389 1e-31 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146956
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Adgrg4 A G X: 56,959,960 N2527S probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Stk26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02253:Stk26 APN X 50886688 missense probably damaging 1.00
IGL03353:Stk26 APN X 50870398 missense probably damaging 0.99
R0664:Stk26 UTSW X 50887926 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAACTAAGGTCAGACGCTC -3'
(R):5'- CAGATGAGAACACAACTATAATGGC -3'

Sequencing Primer
(F):5'- ACTAAGGTCAGACGCTCTGTTAG -3'
(R):5'- GGCATGTATATGAAGATGGTATGATG -3'
Posted On2015-05-15