Incidental Mutation 'R4067:Adgrg4'
ID316196
Institutional Source Beutler Lab
Gene Symbol Adgrg4
Ensembl Gene ENSMUSG00000053852
Gene Nameadhesion G protein-coupled receptor G4
SynonymsGpr112, LOC236798, PGR17
MMRRC Submission 040853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4067 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location56870163-57001558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56959960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 2527 (N2527S)
Ref Sequence ENSEMBL: ENSMUSP00000119486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096431] [ENSMUST00000136396] [ENSMUST00000153784] [ENSMUST00000154818]
Predicted Effect probably benign
Transcript: ENSMUST00000096431
SMART Domains Protein: ENSMUSP00000094165
Gene: ENSMUSG00000053852

DomainStartEndE-ValueType
Pfam:7tm_2 1 75 1.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136396
AA Change: N2485S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116655
Gene: ENSMUSG00000053852
AA Change: N2485S

DomainStartEndE-ValueType
SCOP:d1saca_ 2 159 5e-14 SMART
low complexity region 242 261 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
internal_repeat_1 459 720 5.68e-5 PROSPERO
internal_repeat_1 719 999 5.68e-5 PROSPERO
low complexity region 1013 1024 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1079 1101 N/A INTRINSIC
low complexity region 1243 1261 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1536 1550 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1843 1864 N/A INTRINSIC
low complexity region 1892 1911 N/A INTRINSIC
low complexity region 1953 1970 N/A INTRINSIC
low complexity region 2068 2076 N/A INTRINSIC
low complexity region 2257 2269 N/A INTRINSIC
GPS 2384 2436 1.79e-18 SMART
Pfam:7tm_2 2443 2684 4.8e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153784
AA Change: N2732S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116634
Gene: ENSMUSG00000053852
AA Change: N2732S

DomainStartEndE-ValueType
SCOP:d1saca_ 28 222 1e-17 SMART
low complexity region 305 324 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
internal_repeat_1 522 783 2.5e-5 PROSPERO
internal_repeat_1 782 1062 2.5e-5 PROSPERO
low complexity region 1076 1087 N/A INTRINSIC
low complexity region 1114 1129 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1306 1324 N/A INTRINSIC
low complexity region 1409 1420 N/A INTRINSIC
low complexity region 1599 1613 N/A INTRINSIC
low complexity region 1643 1659 N/A INTRINSIC
low complexity region 1906 1927 N/A INTRINSIC
low complexity region 1955 1974 N/A INTRINSIC
low complexity region 2016 2033 N/A INTRINSIC
low complexity region 2131 2139 N/A INTRINSIC
low complexity region 2289 2300 N/A INTRINSIC
low complexity region 2459 2471 N/A INTRINSIC
GPS 2631 2683 1.79e-18 SMART
Pfam:7tm_2 2691 2932 8.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154818
AA Change: N2527S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119486
Gene: ENSMUSG00000053852
AA Change: N2527S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 100 119 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
internal_repeat_1 317 578 4.23e-5 PROSPERO
internal_repeat_1 577 857 4.23e-5 PROSPERO
low complexity region 871 882 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 937 959 N/A INTRINSIC
low complexity region 1101 1119 N/A INTRINSIC
low complexity region 1204 1215 N/A INTRINSIC
low complexity region 1394 1408 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1701 1722 N/A INTRINSIC
low complexity region 1750 1769 N/A INTRINSIC
low complexity region 1811 1828 N/A INTRINSIC
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 2084 2095 N/A INTRINSIC
low complexity region 2254 2266 N/A INTRINSIC
GPS 2426 2478 1.79e-18 SMART
Pfam:7tm_2 2485 2727 3.9e-52 PFAM
Meta Mutation Damage Score 0.3830 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor belonging to a large family of diverse integral membrane proteins that participate in various physiological functions. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The ligand for this family member is unknown, and it is therefore an orphan receptor. This receptor is known to be expressed in normal enterochromaffin cells and in gastrointestinal neuroendocrine carcinoma cells, and it is therefore considered to be a novel biomarker or target for immunotherapy. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,893,399 T121S possibly damaging Het
4930503E14Rik T C 14: 44,169,184 E136G probably damaging Het
Ak1 G A 2: 32,629,581 S7N probably benign Het
Aktip A C 8: 91,125,838 I230R possibly damaging Het
Alms1 A G 6: 85,621,289 I1032M probably damaging Het
Asb4 T A 6: 5,423,651 V266E probably damaging Het
Bace1 G A 9: 45,854,664 V130M probably damaging Het
BC017643 A T 11: 121,224,702 probably null Het
Bglap A T 3: 88,384,437 probably benign Het
Brpf3 T C 17: 28,821,259 S885P probably benign Het
Chd9 A T 8: 91,023,574 I1742F possibly damaging Het
Col9a2 T A 4: 121,052,389 I415N probably damaging Het
Dnajc7 T C 11: 100,601,781 Y38C probably benign Het
Enam A G 5: 88,503,377 Y840C probably damaging Het
Etnppl T A 3: 130,631,793 C416S probably damaging Het
Fgf20 A T 8: 40,279,855 S181T probably benign Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gcn1l1 T G 5: 115,599,088 L1295R probably damaging Het
Gm11437 A G 11: 84,164,511 V93A probably benign Het
Gm1966 T A 7: 106,599,565 noncoding transcript Het
Gm597 T A 1: 28,777,631 D440V probably damaging Het
Gm9989 T C 3: 81,922,242 noncoding transcript Het
Gsdmc4 A T 15: 63,893,887 probably null Het
Ighv10-1 A T 12: 114,479,023 M114K probably benign Het
Iltifb T C 10: 118,290,210 I161V probably damaging Het
Itfg2 T A 6: 128,410,450 probably benign Het
Kirrel G A 3: 87,088,467 Q387* probably null Het
Klk1 C T 7: 44,227,544 R24* probably null Het
Klra7 T C 6: 130,231,649 probably null Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mrps2 A G 2: 28,469,770 N213S probably benign Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Ntrk3 T A 7: 78,517,437 Y102F probably damaging Het
Olfr1058 A T 2: 86,386,087 C110* probably null Het
Otof C T 5: 30,399,291 G282D probably damaging Het
Pcdhb2 A T 18: 37,297,314 probably null Het
Pign A T 1: 105,587,978 probably null Het
Plekha6 G A 1: 133,294,678 E1001K probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Ppm1d A G 11: 85,345,852 T486A probably benign Het
Pudp A G 18: 50,568,258 F135L probably benign Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Rel A C 11: 23,753,215 probably null Het
Sf3a1 T A 11: 4,167,824 F195L probably damaging Het
Slc30a1 G C 1: 191,907,289 A95P probably damaging Het
Slc47a2 T C 11: 61,303,947 T469A probably benign Het
Slc4a10 A T 2: 62,046,645 M1L probably benign Het
Slc8a1 T A 17: 81,648,274 D445V probably damaging Het
Slc9a7 C T X: 20,205,554 G113R probably damaging Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stk26 A G X: 50,889,033 E317G probably benign Het
Tex10 A T 4: 48,459,355 Y506* probably null Het
Trhde T A 10: 114,444,680 R848* probably null Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Usp24 C T 4: 106,359,089 T379M possibly damaging Het
Wdr34 A G 2: 30,032,808 L309P probably benign Het
Zfp783 A T 6: 47,945,565 noncoding transcript Het
Other mutations in Adgrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03215:Adgrg4 APN X 56977596 missense probably damaging 1.00
R3407:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3408:Adgrg4 UTSW X 56968127 missense probably damaging 0.97
R3947:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R3948:Adgrg4 UTSW X 56917754 missense probably benign 0.25
R4207:Adgrg4 UTSW X 56918749 missense possibly damaging 0.92
R4393:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4395:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4397:Adgrg4 UTSW X 56932343 missense probably damaging 1.00
R4504:Adgrg4 UTSW X 56916442 missense possibly damaging 0.63
Z1176:Adgrg4 UTSW X 56894702 missense probably benign 0.00
Z1176:Adgrg4 UTSW X 56914259 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCATAGGCTGCAGTAAG -3'
(R):5'- GGTAGAATACTCACCCCAGC -3'

Sequencing Primer
(F):5'- CTCATAGGCTGCAGTAAGGGAAC -3'
(R):5'- TGTGTTGAAGACTTTGACTAAAGC -3'
Posted On2015-05-15