Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Pkhd1'

316199

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

040066-MU

Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20612812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 55 (N55K)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088448
AA Change: N55K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: N55K

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147480

Meta Mutation Damage Score

0.0681

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Col12a1	T	A	9: 79,617,705	I2725F	possibly damaging	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Hectd1	A	T	12: 51,794,444	D634E	probably damaging	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mga	A	T	2: 119,964,980		probably benign	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Plch2	A	T	4: 155,042,841		probably benign	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr2	T	C	13: 11,665,878		probably null	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20566874	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20524070	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20081184	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20571390	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20117747	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20523258	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20209176	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20534530	splice site	probably benign
IGL01313:Pkhd1	APN	1	20201024	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20522977	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20549715	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20199459	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20559419	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20116979	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20534633	nonsense	probably null
IGL01790:Pkhd1	APN	1	20558671	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20358910	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20103235	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20220083	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20198137	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20523567	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20522747	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20201227	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20377399	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20117195	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20275615	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20584101	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20209260	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20070376	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20200783	missense	probably benign
IGL02389:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20199486	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20562418	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20414421	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20522759	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20364201	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20392165	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20073507	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20310710	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20520256	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20550902	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20558752	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20220029	splice site	probably benign
IGL02752:Pkhd1	APN	1	20553591	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20361011	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20608416	nonsense	probably null
IGL02960:Pkhd1	APN	1	20377446	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20522963	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20522699	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20565633	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20198171	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20201019	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20081300	splice site	probably benign
IGL03375:Pkhd1	APN	1	20117023	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20200670	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20522894	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20537365	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20611414	intron	probably benign
P0035:Pkhd1	UTSW	1	20117347	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20222906	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0115:Pkhd1	UTSW	1	20350490	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20358917	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20540400	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20549822	splice site	probably null
R0323:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20381547	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20117788	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20559469	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20310514	splice site	probably benign
R0550:Pkhd1	UTSW	1	20347223	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20239436	nonsense	probably null
R0586:Pkhd1	UTSW	1	20524111	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20200890	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20117173	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20117474	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20524230	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20198107	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20117484	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20350521	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20199381	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20201259	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20117726	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20522829	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20567456	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20571405	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20555223	splice site	probably benign
R1411:Pkhd1	UTSW	1	20373896	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20534558	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20522983	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20117401	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20347440	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20117825	missense	probably benign
R1617:Pkhd1	UTSW	1	20198050	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20522897	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20584129	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20550840	splice site	probably benign
R1753:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20565711	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20585152	splice site	probably benign
R1822:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20117069	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20615267	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20566756	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20081300	splice site	probably benign
R1969:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20117060	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20199459	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20200669	missense	probably damaging	1.00
R2062:Pkhd1	UTSW	1	20201335	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20553574	nonsense	probably null
R2142:Pkhd1	UTSW	1	20523895	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20414220	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20553517	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20537360	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20565639	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20534535	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20200849	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20200855	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20201165	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20209182	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20222961	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20104599	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20555129	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20585655	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20058300	makesense	probably null
R3838:Pkhd1	UTSW	1	20534629	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20558723	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20200927	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20312138	nonsense	probably null
R3926:Pkhd1	UTSW	1	20550873	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20209277	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20563686	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20593934	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20058384	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20058617	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20414292	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20239411	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20523314	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20211858	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20534719	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20613409	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20200868	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20503056	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20364167	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20081228	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20524130	missense	probably benign
R4750:Pkhd1	UTSW	1	20524112	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20199415	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20537401	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20070488	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20209226	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20288205	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20585711	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20585191	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20209224	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20547341	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20275641	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20534545	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20350411	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20565870	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20450304	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20392097	missense	probably benign
R5346:Pkhd1	UTSW	1	20523434	missense	probably damaging	0.96
R5431:Pkhd1	UTSW	1	20117836	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20239385	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20201156	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20377404	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20081252	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20523142	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20073526	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20558626	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20588531	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20547461	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20523651	nonsense	probably null
R5760:Pkhd1	UTSW	1	20073554	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20209185	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20058600	missense	probably benign
R5810:Pkhd1	UTSW	1	20200673	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20199405	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20058678	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20201083	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20381461	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20374736	nonsense	probably null
R5852:Pkhd1	UTSW	1	20377408	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20520210	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20523770	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20211951	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20551020	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20585703	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20200823	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20612705	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20058339	missense	probably benign
R6886:Pkhd1	UTSW	1	20347280	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20523515	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20534701	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20562451	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20558719	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20523126	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20547519	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20593953	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20200973	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20239304	missense	not run
R7436:Pkhd1	UTSW	1	20200701	missense	probably benign
R7473:Pkhd1	UTSW	1	20549756	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20347361	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20200925	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20547493	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20562415	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20502999	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20312049	missense	probably benign
R7920:Pkhd1	UTSW	1	20275535	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20508891	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20381438	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20613415	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20523089	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20562458	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20537420	splice site	probably benign
R8485:Pkhd1	UTSW	1	20523033	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20520208	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20522975	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20392150	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20288237	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20073455	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20117561	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20392010	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20347305	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20364201	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20522751	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20502952	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20562362	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20534575	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20373950	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20548127	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20222894	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20612729	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20567517	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20199346	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20392213	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20547466	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20350484	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20414412	missense	probably benign
R9781:Pkhd1	UTSW	1	20117441	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20566849	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20373926	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20520226	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20523747	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20117883	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20310594	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523621	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523938	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20551019	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTAGCATTGCACCCAAAACTG -3'
(R):5'- ATGCCCGTTTCCACCATAGC -3'

Sequencing Primer
(F):5'- TAGCATTGCACCCAAAACTGCTAAG -3'
(R):5'- GAATGAAATGCTCTTTCCTAGGG -3'

Posted On

2015-05-15