Incidental Mutation 'R0390:Cep290'
ID 31621
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms b2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission 038596-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R0390 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 100487558-100574840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100508758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 479 (E479G)
Ref Sequence ENSEMBL: ENSMUSP00000151712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: E486G

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: E486G

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: E479G

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220331
Predicted Effect probably benign
Transcript: ENSMUST00000220346
AA Change: E486G

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Tph2 T C 10: 115,174,109 D182G probably damaging Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
R8443:Cep290 UTSW 10 100495844 missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100551458 missense probably damaging 1.00
R8778:Cep290 UTSW 10 100514512 nonsense probably null
R8975:Cep290 UTSW 10 100513920 missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100541803 missense probably benign 0.44
R9264:Cep290 UTSW 10 100498016 missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9448:Cep290 UTSW 10 100559684 missense probably benign 0.32
R9499:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9507:Cep290 UTSW 10 100494923 missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100568851 missense probably damaging 1.00
R9547:Cep290 UTSW 10 100544979 missense probably benign 0.00
R9551:Cep290 UTSW 10 100536867 missense probably damaging 0.98
R9657:Cep290 UTSW 10 100515141 missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100510542 missense probably damaging 0.98
R9756:Cep290 UTSW 10 100516172 missense probably damaging 0.97
R9777:Cep290 UTSW 10 100518667 missense probably benign 0.01
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACATTGCCTTTGGGCCAGATG -3'
(R):5'- ACTGGGTCGATGAAAGCCATGTTC -3'

Sequencing Primer
(F):5'- GGTATAGGTAAGTTAACCCATCACC -3'
(R):5'- ACTTTGCTTGAGGATTAGGACCAC -3'
Posted On 2013-04-24