Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Mga'

316217

Institutional Source

Beutler Lab

Gene Symbol

Mga

Ensembl Gene

ENSMUSG00000033943

Gene Name

MAX gene associated

Synonyms

D030062C11Rik, Mga, Mad5, C130042M01Rik

MMRRC Submission

040066-MU

Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119897228-119969581 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 119964980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046717

SMART Domains

Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	6e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1796	1818	N/A	INTRINSIC
low complexity region	1833	1850	N/A	INTRINSIC
low complexity region	1977	1992	N/A	INTRINSIC
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2241	2259	N/A	INTRINSIC
HLH	2368	2419	8.27e-7	SMART
low complexity region	2748	2769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079934

SMART Domains

Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART
low complexity region	2578	2599	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110773

SMART Domains

Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	890	899	N/A	INTRINSIC
low complexity region	938	952	N/A	INTRINSIC
low complexity region	1033	1059	N/A	INTRINSIC
low complexity region	1169	1190	N/A	INTRINSIC
low complexity region	1222	1236	N/A	INTRINSIC
low complexity region	1485	1502	N/A	INTRINSIC
low complexity region	1555	1570	N/A	INTRINSIC
low complexity region	1602	1637	N/A	INTRINSIC
low complexity region	1717	1739	N/A	INTRINSIC
low complexity region	1754	1771	N/A	INTRINSIC
low complexity region	1898	1913	N/A	INTRINSIC
low complexity region	2104	2118	N/A	INTRINSIC
low complexity region	2162	2180	N/A	INTRINSIC
HLH	2289	2340	8.27e-7	SMART
low complexity region	2669	2690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110774

SMART Domains

Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	7e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
Pfam:DUF4801	1037	1085	1e-19	PFAM
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1835	1857	N/A	INTRINSIC
low complexity region	1872	1889	N/A	INTRINSIC
low complexity region	2016	2031	N/A	INTRINSIC
low complexity region	2222	2236	N/A	INTRINSIC
low complexity region	2280	2298	N/A	INTRINSIC
HLH	2407	2458	8.27e-7	SMART
low complexity region	2787	2808	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122889

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131396

Predicted Effect

probably benign
Transcript: ENSMUST00000156510

SMART Domains

Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	4e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Col12a1	T	A	9: 79,617,705	I2725F	possibly damaging	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Hectd1	A	T	12: 51,794,444	D634E	probably damaging	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Pkhd1	A	T	1: 20,612,812	N55K	possibly damaging	Het
Plch2	A	T	4: 155,042,841		probably benign	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr2	T	C	13: 11,665,878		probably null	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Mga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Mga	APN	2	119919814	missense	possibly damaging	0.65
IGL00719:Mga	APN	2	119947453	nonsense	probably null
IGL01619:Mga	APN	2	119931828	missense	possibly damaging	0.46
IGL01721:Mga	APN	2	119935239	missense	probably damaging	1.00
IGL01759:Mga	APN	2	119951195	missense	possibly damaging	0.92
IGL01785:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01786:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01950:Mga	APN	2	119941654	missense	possibly damaging	0.60
IGL01960:Mga	APN	2	119938657	missense	probably damaging	1.00
IGL02086:Mga	APN	2	119924036	missense	probably damaging	0.99
IGL02364:Mga	APN	2	119964054	missense	possibly damaging	0.66
IGL02602:Mga	APN	2	119931884	missense	possibly damaging	0.66
IGL02751:Mga	APN	2	119947770	missense	possibly damaging	0.82
IGL02794:Mga	APN	2	119946289	missense	possibly damaging	0.84
IGL03247:Mga	APN	2	119935513	missense	possibly damaging	0.81
IGL03303:Mga	APN	2	119903452	missense	probably damaging	1.00
PIT4515001:Mga	UTSW	2	119916504	missense	probably damaging	1.00
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0417:Mga	UTSW	2	119902790	missense	probably damaging	0.99
R0449:Mga	UTSW	2	119941381	missense	probably damaging	1.00
R0457:Mga	UTSW	2	119916488	missense	probably damaging	0.98
R0538:Mga	UTSW	2	119919706	critical splice donor site	probably null
R0568:Mga	UTSW	2	119935422	missense	probably damaging	1.00
R0614:Mga	UTSW	2	119964466	missense	probably damaging	1.00
R0671:Mga	UTSW	2	119919910	splice site	probably null
R0811:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0812:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0948:Mga	UTSW	2	119941659	missense	possibly damaging	0.77
R1177:Mga	UTSW	2	119926446	missense	probably damaging	1.00
R1445:Mga	UTSW	2	119902698	missense	probably damaging	1.00
R1476:Mga	UTSW	2	119941675	missense	probably damaging	0.96
R1527:Mga	UTSW	2	119916597	missense	probably damaging	1.00
R1583:Mga	UTSW	2	119963960	missense	possibly damaging	0.66
R1592:Mga	UTSW	2	119964666	missense	possibly damaging	0.93
R1627:Mga	UTSW	2	119964562	missense	probably damaging	1.00
R1658:Mga	UTSW	2	119941689	missense	possibly damaging	0.63
R1677:Mga	UTSW	2	119960852	missense	possibly damaging	0.92
R1887:Mga	UTSW	2	119923617	missense	probably damaging	1.00
R1908:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R1909:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R2145:Mga	UTSW	2	119964157	missense	possibly damaging	0.85
R2159:Mga	UTSW	2	119919643	missense	probably damaging	0.96
R2179:Mga	UTSW	2	119960442	missense	probably damaging	0.99
R2281:Mga	UTSW	2	119903723	missense	probably benign
R2423:Mga	UTSW	2	119964793	missense	probably damaging	1.00
R3620:Mga	UTSW	2	119916668	missense	probably damaging	1.00
R3622:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3624:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3802:Mga	UTSW	2	119947339	missense	probably damaging	0.96
R4011:Mga	UTSW	2	119931780	missense	probably damaging	1.00
R4065:Mga	UTSW	2	119947002	missense	probably damaging	1.00
R4520:Mga	UTSW	2	119948098	missense	possibly damaging	0.85
R4649:Mga	UTSW	2	119941493	missense	possibly damaging	0.81
R4660:Mga	UTSW	2	119938623	intron	probably benign
R4757:Mga	UTSW	2	119903639	missense	possibly damaging	0.82
R4771:Mga	UTSW	2	119964294	missense	probably damaging	1.00
R4784:Mga	UTSW	2	119903057	missense	probably damaging	1.00
R4866:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4900:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4952:Mga	UTSW	2	119903301	missense	probably damaging	1.00
R4995:Mga	UTSW	2	119932582	nonsense	probably null
R5020:Mga	UTSW	2	119951173	nonsense	probably null
R5082:Mga	UTSW	2	119903344	missense	probably damaging	0.98
R5208:Mga	UTSW	2	119947981	missense	possibly damaging	0.83
R5454:Mga	UTSW	2	119903329	missense	probably damaging	0.99
R5466:Mga	UTSW	2	119902697	missense	probably damaging	1.00
R5484:Mga	UTSW	2	119916626	missense	possibly damaging	0.58
R5669:Mga	UTSW	2	119903426	missense	probably damaging	1.00
R5819:Mga	UTSW	2	119941263	missense	possibly damaging	0.61
R5916:Mga	UTSW	2	119964312	missense	probably benign	0.27
R5942:Mga	UTSW	2	119946959	missense	probably benign	0.41
R6305:Mga	UTSW	2	119947698	missense	probably benign	0.00
R6434:Mga	UTSW	2	119923938	missense	probably damaging	0.99
R6467:Mga	UTSW	2	119946295	missense	probably damaging	1.00
R6488:Mga	UTSW	2	119960907	missense	probably damaging	1.00
R6630:Mga	UTSW	2	119923659	missense	probably damaging	0.99
R6790:Mga	UTSW	2	119923754	missense	probably damaging	0.99
R7029:Mga	UTSW	2	119923550	missense	probably damaging	1.00
R7039:Mga	UTSW	2	119932678	missense	probably benign	0.28
R7088:Mga	UTSW	2	119961936	missense	probably damaging	1.00
R7195:Mga	UTSW	2	119917328	missense	probably damaging	1.00
R7273:Mga	UTSW	2	119935214	missense	probably damaging	1.00
R7286:Mga	UTSW	2	119964788	missense	possibly damaging	0.93
R7346:Mga	UTSW	2	119935527	missense	possibly damaging	0.56
R7383:Mga	UTSW	2	119960340	missense	probably damaging	0.99
R7469:Mga	UTSW	2	119903046	missense	probably damaging	1.00
R7484:Mga	UTSW	2	119946229	missense	probably damaging	0.99
R7537:Mga	UTSW	2	119935551	missense	probably damaging	0.97
R7781:Mga	UTSW	2	119917357	missense	probably damaging	1.00
R7921:Mga	UTSW	2	119919678	missense	probably damaging	1.00
R8165:Mga	UTSW	2	119947238	missense	probably benign	0.12
R8226:Mga	UTSW	2	119960385	missense	probably benign	0.33
R8305:Mga	UTSW	2	119946319	missense	possibly damaging	0.77
R8309:Mga	UTSW	2	119960930	missense	probably damaging	1.00
R8363:Mga	UTSW	2	119963926	missense	probably benign	0.43
R8388:Mga	UTSW	2	119964081	missense	probably benign	0.00
R8524:Mga	UTSW	2	119941516	missense	probably damaging	0.97
R8693:Mga	UTSW	2	119963926	missense	possibly damaging	0.65
R8837:Mga	UTSW	2	119938791	splice site	probably benign
R8916:Mga	UTSW	2	119958338	missense	possibly damaging	0.92
R8936:Mga	UTSW	2	119964228	missense	probably damaging	1.00
R9028:Mga	UTSW	2	119947589	missense	probably benign
R9145:Mga	UTSW	2	119964012	missense	probably benign
R9155:Mga	UTSW	2	119926532	missense	probably damaging	1.00
R9308:Mga	UTSW	2	119923888	missense	possibly damaging	0.91
R9342:Mga	UTSW	2	119948175	missense	probably benign
R9347:Mga	UTSW	2	119903037	missense	probably damaging	1.00
R9390:Mga	UTSW	2	119963851	missense	probably damaging	0.99
R9408:Mga	UTSW	2	119935518	missense	possibly damaging	0.92
R9488:Mga	UTSW	2	119964823	missense	possibly damaging	0.90
R9495:Mga	UTSW	2	119951195	missense	possibly damaging	0.92
R9521:Mga	UTSW	2	119964498	missense	probably damaging	0.99
R9780:Mga	UTSW	2	119916772	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GGCACCTATAGCTGCCAAAG -3'
(R):5'- CAAGAGGGAATCACACCTTCTTAG -3'

Sequencing Primer
(F):5'- CCAAAGTTGGGTCAATTGGAC -3'
(R):5'- TTCTTAGAGAAGATGAGGGGACCC -3'

Posted On

2015-05-15