Incidental Mutation 'R0390:Tph2'
ID31622
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Nametryptophan hydroxylase 2
Synonyms
MMRRC Submission 038596-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R0390 (G1)
Quality Score194
Status Validated
Chromosome10
Chromosomal Location115078641-115185022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115174109 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 182 (D182G)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
Predicted Effect probably damaging
Transcript: ENSMUST00000006949
AA Change: D182G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: D182G

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155794
Meta Mutation Damage Score 0.9264 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency 98% (110/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730017C20Rik T A 18: 59,075,688 V136E probably damaging Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ap2m1 T C 16: 20,541,099 M183T probably damaging Het
Apob A T 12: 7,988,678 I364F probably damaging Het
Arl6 A T 16: 59,622,421 probably benign Het
Cand2 A G 6: 115,774,653 M15V possibly damaging Het
Cbl A G 9: 44,201,005 F131S probably damaging Het
Ccdc151 T A 9: 21,991,708 H442L probably benign Het
Ccdc74a A G 16: 17,650,476 S321G probably benign Het
Cdc14b T C 13: 64,210,192 probably benign Het
Cep152 T C 2: 125,576,869 probably benign Het
Cep290 A G 10: 100,508,758 E479G probably benign Het
Chrm2 T G 6: 36,524,111 I301R probably benign Het
Clec2e A G 6: 129,093,468 W197R probably damaging Het
Cnot10 G T 9: 114,629,150 S96* probably null Het
Col19a1 A G 1: 24,289,655 probably benign Het
Csmd2 T C 4: 128,133,673 probably benign Het
Cthrc1 A T 15: 39,086,764 *172L probably null Het
Cul9 A T 17: 46,528,589 I821N probably benign Het
Daam1 G C 12: 71,975,304 probably benign Het
Dhx58 A T 11: 100,699,264 I398N probably damaging Het
Dip2b T A 15: 100,193,913 H844Q probably damaging Het
Dmac2 A G 7: 25,621,029 D50G probably damaging Het
Dmxl1 C A 18: 49,879,362 Q1529K probably benign Het
Dtna C T 18: 23,597,501 P315L probably damaging Het
Ep300 T C 15: 81,640,116 S1382P unknown Het
Fat2 A T 11: 55,310,777 N490K probably damaging Het
Flg2 T A 3: 93,200,355 probably benign Het
Gm13084 T A 4: 143,811,699 D234V probably benign Het
Gpatch1 T C 7: 35,281,381 probably benign Het
Grin2a C A 16: 9,579,585 K879N possibly damaging Het
Hacd3 A C 9: 65,001,022 I164S possibly damaging Het
Hinfp A C 9: 44,298,948 C197G probably damaging Het
Hsd17b12 T C 2: 94,114,990 probably benign Het
Hsd3b1 A T 3: 98,853,039 L212Q probably damaging Het
Ifrd1 C T 12: 40,214,094 probably null Het
Igf2bp2 A G 16: 22,081,801 F129L possibly damaging Het
Kirrel3 T A 9: 35,020,163 I409N probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Kpna6 A T 4: 129,657,804 S65R possibly damaging Het
Lama3 A T 18: 12,407,563 D308V probably benign Het
Larp4b T A 13: 9,158,107 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lyzl1 A T 18: 4,169,175 T11S probably benign Het
Man1c1 A G 4: 134,578,315 L366P probably damaging Het
Mef2a A G 7: 67,251,724 M100T probably damaging Het
Mettl13 G A 1: 162,538,889 H474Y possibly damaging Het
Mmp3 A G 9: 7,451,320 D352G probably benign Het
Mns1 T C 9: 72,452,804 I412T probably damaging Het
Mon2 T C 10: 123,007,021 D1501G probably null Het
Mylk G T 16: 34,875,620 G242W probably damaging Het
Nav1 T C 1: 135,449,966 D1715G possibly damaging Het
Nckap1l T C 15: 103,453,883 S2P probably damaging Het
Nek3 A T 8: 22,128,729 probably benign Het
Nfrkb A G 9: 31,388,897 probably benign Het
Nlrp4d T C 7: 10,388,778 D53G probably benign Het
Nol8 T C 13: 49,662,152 S561P probably damaging Het
Nuf2 A C 1: 169,525,297 probably benign Het
Ofcc1 T A 13: 40,015,313 D866V possibly damaging Het
Olfr195 A G 16: 59,149,299 I150V probably benign Het
Optn A G 2: 5,046,195 L125P probably benign Het
Otoa T A 7: 121,131,341 F588Y probably benign Het
Pappa T A 4: 65,351,613 probably null Het
Pde5a T G 3: 122,835,583 C635W probably damaging Het
Pdgfb A T 15: 80,003,419 probably null Het
Pih1d2 T A 9: 50,621,046 C135S probably damaging Het
Plcg1 G T 2: 160,752,366 C361F probably damaging Het
Ppp4r4 T C 12: 103,601,360 probably benign Het
Prdm10 G A 9: 31,349,268 probably null Het
Prex2 T A 1: 11,089,706 probably null Het
Prss56 T G 1: 87,184,730 probably null Het
Prtg A G 9: 72,844,958 K209E probably benign Het
Ptprc G A 1: 138,122,575 T36I possibly damaging Het
Rasgrp4 A G 7: 29,145,860 Y302C probably damaging Het
Rb1cc1 T A 1: 6,248,634 M759K probably damaging Het
Rbm15b T A 9: 106,885,998 M324L probably benign Het
Rcbtb2 T C 14: 73,178,547 V500A probably damaging Het
Rgs6 A G 12: 83,133,677 K434R probably damaging Het
Rims1 C T 1: 22,596,526 A125T possibly damaging Het
Robo3 A G 9: 37,422,177 V746A probably benign Het
Rtl1 C T 12: 109,591,386 E1340K unknown Het
Sacs G A 14: 61,205,640 D1712N possibly damaging Het
Samd4b G A 7: 28,403,977 P19S probably benign Het
Samhd1 T C 2: 157,114,231 Y347C probably damaging Het
Sema6d T A 2: 124,658,490 I393N probably damaging Het
Sigmar1 C T 4: 41,741,243 A4T probably benign Het
Skint9 C A 4: 112,389,179 L245F probably benign Het
Slc35f5 T C 1: 125,585,095 L372P probably damaging Het
Smc1b A T 15: 85,066,277 I1182N probably damaging Het
Smyd3 A G 1: 178,957,573 probably benign Het
Sptlc1 T C 13: 53,337,612 D417G probably benign Het
Sv2c T C 13: 96,088,708 N31S probably benign Het
Tjp1 T C 7: 65,314,990 D811G probably damaging Het
Top2b A G 14: 16,418,442 T1221A probably benign Het
Traf6 C T 2: 101,688,588 Q141* probably null Het
Ttn T C 2: 76,756,931 D21574G probably damaging Het
Uba2 T A 7: 34,151,021 N367I probably benign Het
Ube2b T C 11: 51,988,602 probably benign Het
Ubr5 G T 15: 38,030,672 L426I probably benign Het
Ugt2a2 T A 5: 87,464,148 H301L probably benign Het
Upf2 T A 2: 6,018,894 probably benign Het
Utrn T C 10: 12,710,060 D991G probably benign Het
Vmn2r25 T C 6: 123,823,181 D734G probably damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vwf T A 6: 125,626,361 Y891* probably null Het
Wwox C T 8: 114,706,278 T228I probably benign Het
Zer1 C T 2: 30,108,213 probably benign Het
Zfp180 C T 7: 24,104,707 H184Y possibly damaging Het
Zfp68 A T 5: 138,607,225 Y279N probably benign Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3705:Tph2 UTSW 10 115119893 nonsense probably null
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R4794:Tph2 UTSW 10 115182770 missense possibly damaging 0.84
R5015:Tph2 UTSW 10 115079716 missense probably benign 0.01
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5487:Tph2 UTSW 10 115119874 missense probably damaging 1.00
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R5692:Tph2 UTSW 10 115184827 missense probably damaging 0.97
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R7946:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCTGTCTTCTGCAAGTGGCAAAGTG -3'
(R):5'- CTGATAATTACGCGGAGTGACCGAG -3'

Sequencing Primer
(F):5'- TGAAGAGAAGACAGCTCTGTTTAAC -3'
(R):5'- tcccatacatcccaaatcagtag -3'
Posted On2013-04-24