Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Plch2'

316234

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

040066-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 155042841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141152 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000131173] [ENSMUST00000135665] [ENSMUST00000186598]

AlphaFold

A2AP18

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000097750

SMART Domains

Protein: ENSMUSP00000095357
Gene: ENSMUSG00000073686

Domain	Start	End	E-Value	Type
low complexity region	22	42	N/A	INTRINSIC
low complexity region	108	147	N/A	INTRINSIC
low complexity region	188	204	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131173

SMART Domains

Protein: ENSMUSP00000118629
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
Blast:PH	31	111	6e-49	BLAST
SCOP:d1mai__	34	111	4e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135665

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Col12a1	T	A	9: 79,617,705	I2725F	possibly damaging	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Hectd1	A	T	12: 51,794,444	D634E	probably damaging	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mga	A	T	2: 119,964,980		probably benign	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Pkhd1	A	T	1: 20,612,812	N55K	possibly damaging	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr2	T	C	13: 11,665,878		probably null	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2073:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	splice site	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8516:Plch2	UTSW	4	154986307	missense	probably benign
R8558:Plch2	UTSW	4	154998934	missense	probably damaging	1.00
R8722:Plch2	UTSW	4	154985403	unclassified	probably benign
R8768:Plch2	UTSW	4	154998867	missense	probably damaging	1.00
R8787:Plch2	UTSW	4	154986418	missense	probably benign	0.00
R8826:Plch2	UTSW	4	154986683	missense	probably benign	0.00
R8955:Plch2	UTSW	4	154992566	missense	probably benign	0.00
R9032:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9085:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R9423:Plch2	UTSW	4	154986592	missense
R9649:Plch2	UTSW	4	154984059	missense	probably benign
R9652:Plch2	UTSW	4	154998485	missense	probably benign
R9725:Plch2	UTSW	4	155000535	missense	probably damaging	1.00
R9742:Plch2	UTSW	4	154998455	missense	probably damaging	0.99
R9789:Plch2	UTSW	4	155010865	critical splice donor site	probably null
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGACATCCTGAAACCTGGG -3'
(R):5'- AACCTTAGCCTCAGTCAGAGCC -3'

Sequencing Primer
(F):5'- CCTGGGGAGGAAAGTTTGC -3'
(R):5'- ACCTCGCTGCTGTCAACG -3'

Posted On

2015-05-15