Incidental Mutation 'R2061:Plch2'
ID 316234
Institutional Source Beutler Lab
Gene Symbol Plch2
Ensembl Gene ENSMUSG00000029055
Gene Name phospholipase C, eta 2
Synonyms PLCeta2, Plcl4, A930027K05Rik
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 155067572-155141241 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to T at 155127298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131173] [ENSMUST00000135665] [ENSMUST00000186598]
AlphaFold A2AP18
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097750
SMART Domains Protein: ENSMUSP00000095357
Gene: ENSMUSG00000073686

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
low complexity region 108 147 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131173
SMART Domains Protein: ENSMUSP00000118629
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
Blast:PH 31 111 6e-49 BLAST
SCOP:d1mai__ 34 111 4e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135665
SMART Domains Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
PH 17 126 1.8e-6 SMART
EFh 142 170 7.29e-4 SMART
EFh 178 207 4.67e-2 SMART
Pfam:EF-hand_like 212 294 2.8e-25 PFAM
PLCXc 295 440 6.76e-76 SMART
low complexity region 454 467 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
PLCYc 602 716 1.25e-56 SMART
C2 735 843 1.66e-21 SMART
low complexity region 983 1002 N/A INTRINSIC
low complexity region 1122 1131 N/A INTRINSIC
low complexity region 1251 1264 N/A INTRINSIC
low complexity region 1316 1346 N/A INTRINSIC
low complexity region 1349 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186598
SMART Domains Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

DomainStartEndE-ValueType
C2 79 189 5.8e-18 SMART
low complexity region 328 341 N/A INTRINSIC
low complexity region 407 435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Plch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Plch2 APN 4 155,091,099 (GRCm39) missense probably damaging 1.00
IGL02024:Plch2 APN 4 155,127,595 (GRCm39) intron probably benign
IGL02580:Plch2 APN 4 155,069,221 (GRCm39) missense probably benign 0.03
IGL03370:Plch2 APN 4 155,071,371 (GRCm39) missense probably benign 0.18
IGL03407:Plch2 APN 4 155,074,255 (GRCm39) missense probably damaging 1.00
tolerant UTSW 4 155,069,092 (GRCm39) missense probably benign 0.01
PIT4418001:Plch2 UTSW 4 155,073,960 (GRCm39) missense probably damaging 1.00
PIT4445001:Plch2 UTSW 4 155,093,483 (GRCm39) missense probably damaging 1.00
R0117:Plch2 UTSW 4 155,069,815 (GRCm39) unclassified probably benign
R0347:Plch2 UTSW 4 155,071,178 (GRCm39) missense possibly damaging 0.91
R0361:Plch2 UTSW 4 155,091,168 (GRCm39) missense possibly damaging 0.95
R0413:Plch2 UTSW 4 155,091,373 (GRCm39) critical splice donor site probably null
R0487:Plch2 UTSW 4 155,093,469 (GRCm39) missense probably damaging 1.00
R0514:Plch2 UTSW 4 155,083,343 (GRCm39) missense probably damaging 1.00
R0734:Plch2 UTSW 4 155,080,740 (GRCm39) missense probably damaging 1.00
R0766:Plch2 UTSW 4 155,074,256 (GRCm39) missense probably damaging 1.00
R1306:Plch2 UTSW 4 155,091,597 (GRCm39) missense probably damaging 1.00
R1312:Plch2 UTSW 4 155,074,256 (GRCm39) missense probably damaging 1.00
R1467:Plch2 UTSW 4 155,068,189 (GRCm39) missense probably benign 0.02
R1467:Plch2 UTSW 4 155,068,189 (GRCm39) missense probably benign 0.02
R1602:Plch2 UTSW 4 155,068,907 (GRCm39) missense probably damaging 0.99
R1717:Plch2 UTSW 4 155,082,729 (GRCm39) missense probably benign
R1731:Plch2 UTSW 4 155,091,451 (GRCm39) missense possibly damaging 0.83
R1769:Plch2 UTSW 4 155,084,540 (GRCm39) missense probably damaging 1.00
R1875:Plch2 UTSW 4 155,082,965 (GRCm39) missense probably damaging 1.00
R1974:Plch2 UTSW 4 155,069,410 (GRCm39) missense possibly damaging 0.77
R2031:Plch2 UTSW 4 155,127,484 (GRCm39) intron probably benign
R2050:Plch2 UTSW 4 155,085,275 (GRCm39) missense probably benign 0.00
R2073:Plch2 UTSW 4 155,074,366 (GRCm39) missense probably damaging 1.00
R2075:Plch2 UTSW 4 155,074,366 (GRCm39) missense probably damaging 1.00
R2109:Plch2 UTSW 4 155,069,054 (GRCm39) missense possibly damaging 0.92
R2126:Plch2 UTSW 4 155,083,456 (GRCm39) missense probably damaging 1.00
R2265:Plch2 UTSW 4 155,077,461 (GRCm39) missense probably benign 0.06
R2266:Plch2 UTSW 4 155,077,461 (GRCm39) missense probably benign 0.06
R2269:Plch2 UTSW 4 155,077,461 (GRCm39) missense probably benign 0.06
R2280:Plch2 UTSW 4 155,068,766 (GRCm39) missense probably damaging 1.00
R2281:Plch2 UTSW 4 155,068,766 (GRCm39) missense probably damaging 1.00
R2432:Plch2 UTSW 4 155,070,621 (GRCm39) makesense probably null
R2971:Plch2 UTSW 4 155,075,224 (GRCm39) missense probably benign 0.29
R3437:Plch2 UTSW 4 155,075,470 (GRCm39) critical splice donor site probably null
R3980:Plch2 UTSW 4 155,069,255 (GRCm39) missense probably benign 0.00
R4757:Plch2 UTSW 4 155,080,690 (GRCm39) missense possibly damaging 0.88
R4827:Plch2 UTSW 4 155,075,570 (GRCm39) missense probably damaging 1.00
R4828:Plch2 UTSW 4 155,069,092 (GRCm39) missense probably benign 0.01
R4869:Plch2 UTSW 4 155,073,885 (GRCm39) missense probably benign 0.28
R5020:Plch2 UTSW 4 155,091,540 (GRCm39) missense probably damaging 1.00
R5050:Plch2 UTSW 4 155,127,766 (GRCm39) intron probably benign
R5126:Plch2 UTSW 4 155,084,976 (GRCm39) missense probably damaging 1.00
R5237:Plch2 UTSW 4 155,095,251 (GRCm39) missense probably benign
R5274:Plch2 UTSW 4 155,083,411 (GRCm39) missense probably damaging 1.00
R5296:Plch2 UTSW 4 155,074,456 (GRCm39) splice site probably null
R5324:Plch2 UTSW 4 155,068,991 (GRCm39) missense probably benign
R5475:Plch2 UTSW 4 155,084,594 (GRCm39) missense probably damaging 1.00
R5494:Plch2 UTSW 4 155,075,579 (GRCm39) missense probably damaging 1.00
R5811:Plch2 UTSW 4 155,077,024 (GRCm39) missense possibly damaging 0.62
R6083:Plch2 UTSW 4 155,085,275 (GRCm39) missense probably benign 0.00
R6092:Plch2 UTSW 4 155,068,829 (GRCm39) missense probably benign 0.02
R6253:Plch2 UTSW 4 155,091,558 (GRCm39) missense probably damaging 1.00
R6456:Plch2 UTSW 4 155,077,459 (GRCm39) missense probably damaging 1.00
R7038:Plch2 UTSW 4 155,074,489 (GRCm39) splice site probably null
R7084:Plch2 UTSW 4 155,071,448 (GRCm39) missense probably benign 0.31
R7210:Plch2 UTSW 4 155,093,543 (GRCm39) missense probably damaging 1.00
R7216:Plch2 UTSW 4 155,068,685 (GRCm39) missense probably benign
R7264:Plch2 UTSW 4 155,083,424 (GRCm39) missense probably damaging 0.98
R7291:Plch2 UTSW 4 155,082,929 (GRCm39) missense probably damaging 1.00
R7423:Plch2 UTSW 4 155,068,194 (GRCm39) missense probably damaging 1.00
R7436:Plch2 UTSW 4 155,068,553 (GRCm39) missense probably benign 0.01
R7438:Plch2 UTSW 4 155,084,917 (GRCm39) missense probably damaging 1.00
R7594:Plch2 UTSW 4 155,091,484 (GRCm39) missense probably damaging 1.00
R7663:Plch2 UTSW 4 155,075,619 (GRCm39) missense probably damaging 0.96
R7698:Plch2 UTSW 4 155,087,244 (GRCm39) missense possibly damaging 0.95
R7844:Plch2 UTSW 4 155,073,922 (GRCm39) missense probably damaging 1.00
R7939:Plch2 UTSW 4 155,087,235 (GRCm39) missense possibly damaging 0.91
R8003:Plch2 UTSW 4 155,138,980 (GRCm39) missense unknown
R8007:Plch2 UTSW 4 155,087,288 (GRCm39) missense probably damaging 1.00
R8281:Plch2 UTSW 4 155,091,430 (GRCm39) missense probably benign 0.07
R8434:Plch2 UTSW 4 155,074,192 (GRCm39) missense probably damaging 1.00
R8504:Plch2 UTSW 4 155,068,852 (GRCm39) missense probably benign 0.31
R8516:Plch2 UTSW 4 155,070,764 (GRCm39) missense probably benign
R8558:Plch2 UTSW 4 155,083,391 (GRCm39) missense probably damaging 1.00
R8722:Plch2 UTSW 4 155,069,860 (GRCm39) unclassified probably benign
R8768:Plch2 UTSW 4 155,083,324 (GRCm39) missense probably damaging 1.00
R8787:Plch2 UTSW 4 155,070,875 (GRCm39) missense probably benign 0.00
R8826:Plch2 UTSW 4 155,071,140 (GRCm39) missense probably benign 0.00
R8955:Plch2 UTSW 4 155,077,023 (GRCm39) missense probably benign 0.00
R9032:Plch2 UTSW 4 155,084,976 (GRCm39) missense probably damaging 1.00
R9085:Plch2 UTSW 4 155,084,976 (GRCm39) missense probably damaging 1.00
R9423:Plch2 UTSW 4 155,071,049 (GRCm39) missense
R9649:Plch2 UTSW 4 155,068,516 (GRCm39) missense probably benign
R9652:Plch2 UTSW 4 155,082,942 (GRCm39) missense probably benign
R9725:Plch2 UTSW 4 155,084,992 (GRCm39) missense probably damaging 1.00
R9742:Plch2 UTSW 4 155,082,912 (GRCm39) missense probably damaging 0.99
R9789:Plch2 UTSW 4 155,095,322 (GRCm39) critical splice donor site probably null
RF014:Plch2 UTSW 4 155,091,577 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACATCCTGAAACCTGGG -3'
(R):5'- AACCTTAGCCTCAGTCAGAGCC -3'

Sequencing Primer
(F):5'- CCTGGGGAGGAAAGTTTGC -3'
(R):5'- ACCTCGCTGCTGTCAACG -3'
Posted On 2015-05-15