Incidental Mutation 'R2061:Tacr1'
ID316241
Institutional Source Beutler Lab
Gene Symbol Tacr1
Ensembl Gene ENSMUSG00000030043
Gene Nametachykinin receptor 1
Synonymssubstance p receptor, Tac1r, NK1 receptor, SPr, NK1-R, neurokinin receptor 1, NK-1R
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2061 (G1)
Quality Score218
Status Validated
Chromosome6
Chromosomal Location82402334-82560104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82492554 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 140 (P140S)
Ref Sequence ENSEMBL: ENSMUSP00000145217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032122] [ENSMUST00000203775]
Predicted Effect probably damaging
Transcript: ENSMUST00000032122
AA Change: P140S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032122
Gene: ENSMUSG00000030043
AA Change: P140S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203775
AA Change: P140S

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145217
Gene: ENSMUSG00000030043
AA Change: P140S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Meta Mutation Damage Score 0.6914 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: This gene encodes the receptor for the tachykinin, substance P, also referred to as neurokinin 1. This gene belongs to a gene family of tachykinin receptors which are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This receptor has been associated with nitric oxide formation, and it has been localized to cholinergic and nitrergic neurons as well as on smooth muscle cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced anxiety, pain and stress-related responses, reduced immunological response after a viral challenge, and reduced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Col12a1 T A 9: 79,617,705 I2725F possibly damaging Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dmbt1 T G 7: 131,099,133 C1014G possibly damaging Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Helz2 A G 2: 181,240,544 I152T probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kdm5a G T 6: 120,381,617 R207L probably benign Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Madd A C 2: 91,161,486 probably benign Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Tacr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Tacr1 APN 6 82403655 missense probably benign 0.01
IGL01875:Tacr1 APN 6 82557016 missense probably benign 0.18
IGL02092:Tacr1 APN 6 82403919 missense probably damaging 1.00
IGL02506:Tacr1 APN 6 82403758 missense probably damaging 1.00
IGL02651:Tacr1 APN 6 82492641 missense probably damaging 0.98
R0627:Tacr1 UTSW 6 82555031 missense possibly damaging 0.93
R0732:Tacr1 UTSW 6 82552901 missense probably damaging 1.00
R1279:Tacr1 UTSW 6 82557183 nonsense probably null
R1292:Tacr1 UTSW 6 82554875 missense probably damaging 0.98
R1480:Tacr1 UTSW 6 82492530 missense possibly damaging 0.47
R1595:Tacr1 UTSW 6 82403742 missense probably benign 0.05
R2260:Tacr1 UTSW 6 82403775 missense probably damaging 1.00
R2697:Tacr1 UTSW 6 82492597 missense probably damaging 1.00
R2941:Tacr1 UTSW 6 82403734 missense probably damaging 1.00
R4629:Tacr1 UTSW 6 82403880 missense probably benign 0.02
R4780:Tacr1 UTSW 6 82557072 missense probably benign
R4916:Tacr1 UTSW 6 82554941 missense probably benign 0.00
R5065:Tacr1 UTSW 6 82554878 missense possibly damaging 0.94
R5801:Tacr1 UTSW 6 82557153 missense probably benign 0.04
R6919:Tacr1 UTSW 6 82557073 missense probably benign 0.03
R6941:Tacr1 UTSW 6 82403865 missense possibly damaging 0.75
R7269:Tacr1 UTSW 6 82492711 missense probably benign
R8717:Tacr1 UTSW 6 82403725 missense probably damaging 1.00
R8912:Tacr1 UTSW 6 82557033 missense probably damaging 0.99
Z1177:Tacr1 UTSW 6 82554997 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGAGGACCTGAGTTAGTCCAC -3'
(R):5'- ACGCTTTCTCGTAAGTCCTG -3'

Sequencing Primer
(F):5'- TGGAGACACCCAACTTGTTG -3'
(R):5'- GTTGGGATGTTCTGGCCACTC -3'
Posted On2015-05-15