Incidental Mutation 'R2061:Col12a1'
ID 316262
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Name collagen, type XII, alpha 1
Synonyms
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.839) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 79506273-79626113 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79524987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2725 (I2725F)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071750
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: I2725F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121227
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: I2725F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135009
SMART Domains Protein: ENSMUSP00000123455
Gene: ENSMUSG00000032332

DomainStartEndE-ValueType
Pfam:Collagen 1 56 6.1e-11 PFAM
Pfam:Collagen 40 98 1.4e-11 PFAM
Pfam:Collagen 133 188 9.2e-10 PFAM
low complexity region 205 238 N/A INTRINSIC
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Jmjd1c A T 10: 67,054,205 (GRCm39) E323D probably damaging Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79,588,819 (GRCm39) missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79,560,614 (GRCm39) missense probably benign 0.27
IGL00465:Col12a1 APN 9 79,604,863 (GRCm39) missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79,558,759 (GRCm39) missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79,554,934 (GRCm39) missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79,599,508 (GRCm39) missense probably benign 0.05
IGL01015:Col12a1 APN 9 79,541,023 (GRCm39) missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79,611,129 (GRCm39) missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79,585,335 (GRCm39) missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79,551,208 (GRCm39) missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79,564,648 (GRCm39) missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79,508,451 (GRCm39) makesense probably null
IGL01878:Col12a1 APN 9 79,557,257 (GRCm39) missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79,557,299 (GRCm39) missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79,599,654 (GRCm39) missense probably benign 0.06
IGL02123:Col12a1 APN 9 79,569,740 (GRCm39) critical splice donor site probably null
IGL02312:Col12a1 APN 9 79,588,797 (GRCm39) missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79,523,303 (GRCm39) critical splice donor site probably null
IGL02328:Col12a1 APN 9 79,589,348 (GRCm39) missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79,557,178 (GRCm39) splice site probably null
IGL02355:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02362:Col12a1 APN 9 79,537,993 (GRCm39) splice site probably benign
IGL02396:Col12a1 APN 9 79,569,865 (GRCm39) missense probably benign
IGL02449:Col12a1 APN 9 79,548,751 (GRCm39) missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79,606,623 (GRCm39) missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79,521,141 (GRCm39) unclassified probably benign
IGL02801:Col12a1 APN 9 79,515,696 (GRCm39) splice site probably null
IGL03001:Col12a1 APN 9 79,540,955 (GRCm39) missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79,548,833 (GRCm39) missense probably benign 0.40
IGL03090:Col12a1 APN 9 79,585,652 (GRCm39) missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79,588,719 (GRCm39) missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79,606,765 (GRCm39) missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79,585,665 (GRCm39) splice site probably null
IGL03348:Col12a1 APN 9 79,600,712 (GRCm39) missense possibly damaging 0.88
airship UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
dirigible UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
Feast UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
hardly UTSW 9 79,607,632 (GRCm39) nonsense probably null
hearty UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
Hefty UTSW 9 79,569,736 (GRCm39) splice site probably benign
P0045:Col12a1 UTSW 9 79,554,893 (GRCm39) missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79,558,662 (GRCm39) critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79,585,387 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79,558,667 (GRCm39) missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79,559,315 (GRCm39) missense probably benign 0.02
R0276:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R0309:Col12a1 UTSW 9 79,507,293 (GRCm39) splice site probably null
R0336:Col12a1 UTSW 9 79,609,627 (GRCm39) missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79,600,776 (GRCm39) missense probably benign 0.10
R0413:Col12a1 UTSW 9 79,606,642 (GRCm39) missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79,588,750 (GRCm39) missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79,512,610 (GRCm39) critical splice donor site probably null
R0610:Col12a1 UTSW 9 79,615,130 (GRCm39) missense probably benign
R0631:Col12a1 UTSW 9 79,610,658 (GRCm39) missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79,564,017 (GRCm39) missense probably benign 0.00
R0667:Col12a1 UTSW 9 79,535,744 (GRCm39) missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79,559,317 (GRCm39) missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79,519,701 (GRCm39) missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79,588,656 (GRCm39) splice site probably benign
R0787:Col12a1 UTSW 9 79,545,767 (GRCm39) missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79,607,684 (GRCm39) missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79,591,535 (GRCm39) missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79,607,005 (GRCm39) missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R1321:Col12a1 UTSW 9 79,524,991 (GRCm39) nonsense probably null
R1344:Col12a1 UTSW 9 79,606,837 (GRCm39) nonsense probably null
R1387:Col12a1 UTSW 9 79,588,657 (GRCm39) splice site probably benign
R1511:Col12a1 UTSW 9 79,606,834 (GRCm39) missense probably benign 0.02
R1523:Col12a1 UTSW 9 79,568,278 (GRCm39) missense probably benign 0.01
R1526:Col12a1 UTSW 9 79,564,080 (GRCm39) missense probably benign 0.44
R1564:Col12a1 UTSW 9 79,521,122 (GRCm39) missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79,509,536 (GRCm39) missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79,520,244 (GRCm39) missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79,600,820 (GRCm39) missense probably benign 0.00
R1730:Col12a1 UTSW 9 79,535,660 (GRCm39) missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79,610,733 (GRCm39) missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79,540,750 (GRCm39) missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79,580,279 (GRCm39) missense probably benign 0.01
R1778:Col12a1 UTSW 9 79,511,867 (GRCm39) splice site probably benign
R1845:Col12a1 UTSW 9 79,604,823 (GRCm39) missense probably benign 0.09
R1864:Col12a1 UTSW 9 79,534,385 (GRCm39) splice site probably null
R1876:Col12a1 UTSW 9 79,585,563 (GRCm39) nonsense probably null
R1934:Col12a1 UTSW 9 79,511,804 (GRCm39) nonsense probably null
R1942:Col12a1 UTSW 9 79,542,748 (GRCm39) missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79,553,075 (GRCm39) critical splice acceptor site probably null
R2064:Col12a1 UTSW 9 79,569,736 (GRCm39) splice site probably benign
R2070:Col12a1 UTSW 9 79,554,978 (GRCm39) missense probably benign 0.00
R2112:Col12a1 UTSW 9 79,551,181 (GRCm39) missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79,599,634 (GRCm39) missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79,542,709 (GRCm39) missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79,540,939 (GRCm39) missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79,564,095 (GRCm39) missense probably benign 0.03
R2425:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79,509,533 (GRCm39) missense probably benign 0.30
R2437:Col12a1 UTSW 9 79,599,501 (GRCm39) missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79,604,683 (GRCm39) missense probably null 0.99
R2851:Col12a1 UTSW 9 79,585,614 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79,606,831 (GRCm39) missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79,559,307 (GRCm39) missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79,607,547 (GRCm39) missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79,551,229 (GRCm39) missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3430:Col12a1 UTSW 9 79,587,593 (GRCm39) missense probably benign
R3547:Col12a1 UTSW 9 79,540,698 (GRCm39) missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79,547,005 (GRCm39) missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79,609,646 (GRCm39) missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79,607,671 (GRCm39) missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79,538,023 (GRCm39) nonsense probably null
R4392:Col12a1 UTSW 9 79,569,770 (GRCm39) missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79,547,247 (GRCm39) critical splice donor site probably null
R4465:Col12a1 UTSW 9 79,580,192 (GRCm39) missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79,540,639 (GRCm39) missense probably benign 0.00
R4612:Col12a1 UTSW 9 79,523,339 (GRCm39) missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79,554,883 (GRCm39) missense probably benign 0.03
R4649:Col12a1 UTSW 9 79,547,076 (GRCm39) missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79,520,228 (GRCm39) missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79,606,564 (GRCm39) missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79,559,368 (GRCm39) splice site probably null
R4761:Col12a1 UTSW 9 79,564,592 (GRCm39) missense probably benign 0.34
R4784:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79,585,776 (GRCm39) missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79,600,849 (GRCm39) missense probably benign 0.10
R4821:Col12a1 UTSW 9 79,622,622 (GRCm39) intron probably benign
R4925:Col12a1 UTSW 9 79,582,077 (GRCm39) missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79,607,632 (GRCm39) nonsense probably null
R5034:Col12a1 UTSW 9 79,564,649 (GRCm39) missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79,512,456 (GRCm39) missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79,551,248 (GRCm39) missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79,613,582 (GRCm39) missense probably benign 0.00
R5152:Col12a1 UTSW 9 79,564,030 (GRCm39) missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79,607,544 (GRCm39) missense probably benign 0.00
R5268:Col12a1 UTSW 9 79,585,329 (GRCm39) missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79,527,342 (GRCm39) missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79,585,648 (GRCm39) missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79,521,645 (GRCm39) missense probably benign 0.07
R5496:Col12a1 UTSW 9 79,509,467 (GRCm39) splice site probably benign
R5537:Col12a1 UTSW 9 79,606,872 (GRCm39) missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79,611,041 (GRCm39) missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79,606,603 (GRCm39) missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79,523,347 (GRCm39) nonsense probably null
R5796:Col12a1 UTSW 9 79,611,111 (GRCm39) missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79,540,955 (GRCm39) missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79,511,760 (GRCm39) missense probably benign 0.00
R5919:Col12a1 UTSW 9 79,509,580 (GRCm39) missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79,589,409 (GRCm39) missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79,585,788 (GRCm39) missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79,537,842 (GRCm39) missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79,563,860 (GRCm39) critical splice donor site probably null
R6090:Col12a1 UTSW 9 79,599,675 (GRCm39) missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79,521,640 (GRCm39) missense probably benign 0.00
R6393:Col12a1 UTSW 9 79,562,767 (GRCm39) missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79,552,973 (GRCm39) missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79,554,887 (GRCm39) missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79,557,231 (GRCm39) missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79,527,331 (GRCm39) missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79,606,887 (GRCm39) missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79,540,706 (GRCm39) missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79,613,619 (GRCm39) missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79,584,516 (GRCm39) missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79,547,091 (GRCm39) missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79,607,782 (GRCm39) missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79,557,314 (GRCm39) missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79,589,348 (GRCm39) missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79,613,642 (GRCm39) missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79,562,689 (GRCm39) missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79,520,192 (GRCm39) splice site probably null
R7584:Col12a1 UTSW 9 79,610,578 (GRCm39) critical splice donor site probably null
R7624:Col12a1 UTSW 9 79,553,076 (GRCm39) splice site probably null
R7670:Col12a1 UTSW 9 79,538,925 (GRCm39) missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79,558,768 (GRCm39) missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79,588,803 (GRCm39) missense probably damaging 1.00
R7796:Col12a1 UTSW 9 79,585,833 (GRCm39) missense possibly damaging 0.88
R7902:Col12a1 UTSW 9 79,548,863 (GRCm39) missense probably benign 0.00
R7923:Col12a1 UTSW 9 79,585,775 (GRCm39) missense probably benign 0.00
R7986:Col12a1 UTSW 9 79,511,674 (GRCm39) critical splice donor site probably null
R8004:Col12a1 UTSW 9 79,591,683 (GRCm39) missense probably damaging 1.00
R8046:Col12a1 UTSW 9 79,613,508 (GRCm39) critical splice donor site probably null
R8056:Col12a1 UTSW 9 79,507,220 (GRCm39) missense
R8151:Col12a1 UTSW 9 79,537,831 (GRCm39) missense possibly damaging 0.62
R8203:Col12a1 UTSW 9 79,588,831 (GRCm39) missense possibly damaging 0.94
R8221:Col12a1 UTSW 9 79,551,224 (GRCm39) missense probably damaging 1.00
R8294:Col12a1 UTSW 9 79,606,594 (GRCm39) missense possibly damaging 0.91
R8309:Col12a1 UTSW 9 79,512,465 (GRCm39) missense possibly damaging 0.68
R8319:Col12a1 UTSW 9 79,555,979 (GRCm39) missense probably damaging 0.97
R8351:Col12a1 UTSW 9 79,588,694 (GRCm39) missense probably damaging 0.97
R8442:Col12a1 UTSW 9 79,542,781 (GRCm39) missense probably damaging 1.00
R8500:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably damaging 1.00
R8682:Col12a1 UTSW 9 79,568,358 (GRCm39) missense probably benign 0.03
R8700:Col12a1 UTSW 9 79,527,371 (GRCm39) missense probably benign 0.09
R8859:Col12a1 UTSW 9 79,587,681 (GRCm39) nonsense probably null
R8898:Col12a1 UTSW 9 79,599,577 (GRCm39) missense probably benign 0.08
R8930:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8932:Col12a1 UTSW 9 79,580,665 (GRCm39) missense probably benign
R8949:Col12a1 UTSW 9 79,581,970 (GRCm39) missense probably benign 0.17
R8962:Col12a1 UTSW 9 79,538,901 (GRCm39) missense probably damaging 1.00
R9045:Col12a1 UTSW 9 79,582,034 (GRCm39) missense probably benign 0.00
R9080:Col12a1 UTSW 9 79,517,133 (GRCm39) missense probably benign 0.06
R9145:Col12a1 UTSW 9 79,527,344 (GRCm39) missense probably benign 0.16
R9163:Col12a1 UTSW 9 79,548,729 (GRCm39) critical splice donor site probably null
R9168:Col12a1 UTSW 9 79,548,783 (GRCm39) nonsense probably null
R9188:Col12a1 UTSW 9 79,509,614 (GRCm39) missense probably benign 0.22
R9258:Col12a1 UTSW 9 79,613,645 (GRCm39) missense probably benign 0.04
R9292:Col12a1 UTSW 9 79,585,805 (GRCm39) missense probably benign 0.33
R9345:Col12a1 UTSW 9 79,541,017 (GRCm39) missense probably benign 0.08
R9382:Col12a1 UTSW 9 79,589,364 (GRCm39) missense probably benign 0.23
R9427:Col12a1 UTSW 9 79,589,445 (GRCm39) missense probably benign 0.15
R9601:Col12a1 UTSW 9 79,525,034 (GRCm39) missense probably damaging 0.98
R9653:Col12a1 UTSW 9 79,584,556 (GRCm39) missense probably benign
R9668:Col12a1 UTSW 9 79,546,960 (GRCm39) nonsense probably null
R9762:Col12a1 UTSW 9 79,527,266 (GRCm39) missense possibly damaging 0.82
X0021:Col12a1 UTSW 9 79,515,767 (GRCm39) missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79,509,506 (GRCm39) missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79,519,674 (GRCm39) splice site probably null
Z1177:Col12a1 UTSW 9 79,507,268 (GRCm39) missense possibly damaging 0.80
Z1177:Col12a1 UTSW 9 79,546,978 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCAAAAGGTCACGTGAGCC -3'
(R):5'- GAGAGACTCTACCTCAAATTGGTG -3'

Sequencing Primer
(F):5'- CCTGGCCTGAGCTGTGGTAAC -3'
(R):5'- CATTTTACACGCAAAAGGGAGTG -3'
Posted On 2015-05-15