Incidental Mutation 'R2061:Col12a1'
ID316262
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
MMRRC Submission 040066-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R2061 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79617705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2725 (I2725F)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071750
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: I2725F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121227
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: I2725F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135009
SMART Domains Protein: ENSMUSP00000123455
Gene: ENSMUSG00000032332

DomainStartEndE-ValueType
Pfam:Collagen 1 56 6.1e-11 PFAM
Pfam:Collagen 40 98 1.4e-11 PFAM
Pfam:Collagen 133 188 9.2e-10 PFAM
low complexity region 205 238 N/A INTRINSIC
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,268,314 M395V probably benign Het
2610507B11Rik T A 11: 78,268,749 C541* probably null Het
9130011E15Rik C T 19: 45,978,667 R12Q probably damaging Het
A4gnt T C 9: 99,620,359 S191P probably damaging Het
AI314180 G T 4: 58,824,270 P1116T probably damaging Het
Ak2 C T 4: 129,008,197 A221V probably damaging Het
Akap9 T A 5: 3,961,010 V571E probably damaging Het
Amph G T 13: 19,125,035 E428* probably null Het
Arnt2 T A 7: 84,343,870 D154V probably damaging Het
Arrdc1 G A 2: 24,926,352 Q202* probably null Het
Ate1 A G 7: 130,510,913 C72R probably damaging Het
Atox1 A G 11: 55,454,898 V22A possibly damaging Het
Bbs12 A T 3: 37,319,066 M3L probably damaging Het
BC067074 T A 13: 113,318,094 W225R probably damaging Het
Bfsp1 A G 2: 143,862,678 V85A probably benign Het
Caskin2 C A 11: 115,803,630 V382F probably benign Het
Ccdc39 T A 3: 33,819,896 M596L probably damaging Het
Cd22 C T 7: 30,870,105 V529M probably damaging Het
Cd22 A C 7: 30,876,156 Y154D probably benign Het
Cdadc1 T A 14: 59,581,334 E348D probably damaging Het
Cdhr2 T C 13: 54,720,818 V531A probably damaging Het
Cdk11b A G 4: 155,641,604 probably benign Het
Cebpa G T 7: 35,119,522 R35L probably damaging Het
Chat T C 14: 32,446,873 N235S probably benign Het
Cracr2b A G 7: 141,465,280 E231G probably damaging Het
Cryaa G T 17: 31,681,055 A151S probably benign Het
Dab1 A T 4: 104,678,741 I116F probably damaging Het
Ddx43 C A 9: 78,396,104 N75K probably benign Het
Dmbt1 T G 7: 131,099,133 C1014G possibly damaging Het
Dner C A 1: 84,405,989 C558F probably damaging Het
Dsc2 A G 18: 20,032,399 V839A possibly damaging Het
Dsg3 C T 18: 20,527,737 R378* probably null Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha6 T C 16: 59,655,797 M1069V probably damaging Het
F930017D23Rik A C 10: 43,604,420 noncoding transcript Het
Faf1 A T 4: 109,710,808 N22Y probably damaging Het
Flrt3 A T 2: 140,661,453 V85E probably damaging Het
Gadl1 T A 9: 115,941,380 I87N probably damaging Het
Galnt14 A G 17: 73,512,153 F314S probably damaging Het
Gba2 A T 4: 43,574,029 Y141* probably null Het
Gdap1 A T 1: 17,145,465 probably benign Het
Gfod1 A T 13: 43,303,243 probably null Het
Gm14295 C T 2: 176,810,681 R655* probably null Het
Gm4353 A G 7: 116,083,699 S216P probably damaging Het
Gm6605 T A 7: 38,448,282 noncoding transcript Het
Hectd1 A T 12: 51,794,444 D634E probably damaging Het
Helz2 A G 2: 181,240,544 I152T probably damaging Het
Hivep1 A G 13: 42,160,124 K1947E possibly damaging Het
Ifrd1 A T 12: 40,213,245 F144L probably benign Het
Itgae A T 11: 73,118,622 Q544L probably benign Het
Jmjd1c A T 10: 67,218,426 E323D probably damaging Het
Kdm5a G T 6: 120,381,617 R207L probably benign Het
Kif5b C T 18: 6,226,377 probably null Het
Lbp T C 2: 158,324,579 V351A probably benign Het
Lss A T 10: 76,546,098 probably null Het
Madd A C 2: 91,161,486 probably benign Het
Map6 G A 7: 99,317,472 V503I probably damaging Het
Mark1 A G 1: 184,928,063 L22P probably damaging Het
Mcfd2 T C 17: 87,255,976 N130D probably damaging Het
Mcm3ap A G 10: 76,470,068 N5S probably benign Het
Mdm4 A T 1: 133,012,651 F48I probably damaging Het
Mga A T 2: 119,964,980 probably benign Het
Mknk2 A T 10: 80,671,557 probably null Het
Mmp15 T C 8: 95,370,779 Y459H possibly damaging Het
Mthfd1l A G 10: 4,103,288 K879R probably benign Het
Mycbp2 T C 14: 103,287,260 K655E probably damaging Het
Nasp T C 4: 116,611,126 N221D probably benign Het
Ndc80 T C 17: 71,514,218 E245G probably benign Het
Nmral1 C T 16: 4,716,329 E83K probably damaging Het
Noa1 T A 5: 77,304,187 Q550L possibly damaging Het
Nutm1 A T 2: 112,255,752 Y211* probably null Het
Olfr1420 T A 19: 11,896,557 Y179N probably damaging Het
Olfr1474 A G 19: 13,471,241 I90M probably damaging Het
Olfr148 G T 9: 39,613,775 M69I probably benign Het
Olfr700 A C 7: 106,805,768 H231Q probably benign Het
Olfr723 T C 14: 49,929,021 I174M possibly damaging Het
Otoa T C 7: 121,131,328 F584L probably damaging Het
Palb2 G A 7: 122,124,525 T304I possibly damaging Het
Pcolce2 A T 9: 95,670,176 M121L probably benign Het
Pcsk5 T C 19: 17,454,872 T1460A probably benign Het
Pdzrn4 A T 15: 92,770,160 D731V probably damaging Het
Pex11b C A 3: 96,635,721 Q12K possibly damaging Het
Pigw G C 11: 84,877,310 Q398E probably benign Het
Pkd1 A G 17: 24,569,914 E882G possibly damaging Het
Pkhd1 A T 1: 20,612,812 N55K possibly damaging Het
Plch2 A T 4: 155,042,841 probably benign Het
Plcl1 T A 1: 55,751,345 L1058Q probably benign Het
Ppfia2 T C 10: 106,837,329 S511P possibly damaging Het
Ppfibp2 T C 7: 107,739,230 L676P probably damaging Het
Ppp6c T G 2: 39,226,174 D23A probably damaging Het
Pqlc1 G T 18: 80,291,715 A232S probably benign Het
Prss30 G A 17: 23,974,668 probably benign Het
Ptprz1 T C 6: 23,049,675 probably null Het
Rec114 T A 9: 58,652,905 probably benign Het
Ryr2 T C 13: 11,665,878 probably null Het
Ryr3 A T 2: 112,663,004 I3715N possibly damaging Het
Scin T C 12: 40,080,948 Y322C probably damaging Het
Scn3a A G 2: 65,461,308 V1698A probably damaging Het
Scn5a G A 9: 119,485,651 S1996L probably damaging Het
Serpinb2 A G 1: 107,522,795 K174R possibly damaging Het
Slc16a4 T C 3: 107,300,711 I179T probably benign Het
Slc35b1 T G 11: 95,385,892 F102V possibly damaging Het
Slc6a15 A G 10: 103,409,734 D526G probably benign Het
Spata16 A G 3: 26,924,370 D495G probably damaging Het
Stk11ip G A 1: 75,529,584 E583K possibly damaging Het
Stk-ps1 T G 17: 36,398,152 noncoding transcript Het
Sufu T A 19: 46,397,212 I37N probably damaging Het
Tacr1 C T 6: 82,492,554 P140S probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tenm3 C T 8: 48,342,256 probably null Het
Tex36 A T 7: 133,595,223 I55N probably damaging Het
Tmem150c T C 5: 100,080,028 Y192C probably damaging Het
Tmem237 A G 1: 59,120,286 probably benign Het
Trim11 A G 11: 58,982,063 E191G probably damaging Het
Ttll3 C T 6: 113,409,042 A612V possibly damaging Het
Ttn G A 2: 76,977,122 A89V probably damaging Het
Usp37 A G 1: 74,468,272 F529L probably damaging Het
Vmn1r217 A C 13: 23,114,528 V68G probably benign Het
Vwf T C 6: 125,591,188 S349P probably damaging Het
Wt1 G A 2: 105,131,157 probably null Het
Zcchc7 T A 4: 44,895,838 L262H probably damaging Het
Zfp873 A G 10: 82,060,157 S241G probably benign Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
Feast UTSW 9 79700262 missense probably benign 0.00
hardly UTSW 9 79700350 nonsense probably null
hearty UTSW 9 79643966 missense probably damaging 1.00
Hefty UTSW 9 79662454 splice site probably benign
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
PIT4260001:Col12a1 UTSW 9 79651380 critical splice donor site probably null
PIT4280001:Col12a1 UTSW 9 79678105 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79699321 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79682127 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
R7198:Col12a1 UTSW 9 79650032 missense possibly damaging 0.56
R7296:Col12a1 UTSW 9 79682066 missense probably damaging 1.00
R7365:Col12a1 UTSW 9 79706360 missense probably damaging 0.99
R7466:Col12a1 UTSW 9 79655407 missense possibly damaging 0.95
R7516:Col12a1 UTSW 9 79612910 splice site probably null
R7584:Col12a1 UTSW 9 79703296 critical splice donor site probably null
R7670:Col12a1 UTSW 9 79631643 missense probably damaging 1.00
R7678:Col12a1 UTSW 9 79651486 missense probably damaging 0.99
R7702:Col12a1 UTSW 9 79681521 missense probably damaging 1.00
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCAAAAGGTCACGTGAGCC -3'
(R):5'- GAGAGACTCTACCTCAAATTGGTG -3'

Sequencing Primer
(F):5'- CCTGGCCTGAGCTGTGGTAAC -3'
(R):5'- CATTTTACACGCAAAAGGGAGTG -3'
Posted On2015-05-15