Mutagenetix > Incidental Mutation

Incidental Mutation 'R2061:Col12a1'

316262

Institutional Source

Beutler Lab

Gene Symbol

Col12a1

Ensembl Gene

ENSMUSG00000032332

Gene Name

collagen, type XII, alpha 1

Synonyms

MMRRC Submission

040066-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R2061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79598991-79718831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 79617705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 2725 (I2725F)

Ref Sequence

ENSEMBL: ENSMUSP00000112604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071750
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: I2725F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	1.7e-8	PFAM
Pfam:Collagen	2802	2855	6.5e-9	PFAM
Pfam:Collagen	2844	2904	1.1e-9	PFAM
Pfam:Collagen	2939	2994	4.6e-8	PFAM
low complexity region	3011	3044	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121227
AA Change: I2725F

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: I2725F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
FN3	25	103	2.29e-10	SMART
low complexity region	114	129	N/A	INTRINSIC
VWA	138	317	4e-63	SMART
FN3	334	413	1.47e-8	SMART
VWA	438	617	2.41e-57	SMART
FN3	632	710	1.62e-10	SMART
FN3	723	801	2.91e-12	SMART
FN3	814	892	6.05e-10	SMART
FN3	905	984	2.74e-8	SMART
FN3	995	1074	1.24e-6	SMART
FN3	1087	1166	5.78e-7	SMART
VWA	1197	1376	2.02e-59	SMART
FN3	1385	1463	1.13e-9	SMART
FN3	1474	1554	1.07e-10	SMART
FN3	1566	1643	3.73e-10	SMART
FN3	1655	1734	2.94e-8	SMART
FN3	1755	1834	1.54e-11	SMART
FN3	1846	1924	1.45e-7	SMART
FN3	1936	2015	1.47e-8	SMART
FN3	2027	2106	1.21e-9	SMART
FN3	2118	2195	2.14e-10	SMART
FN3	2206	2285	3.85e-3	SMART
low complexity region	2292	2314	N/A	INTRINSIC
VWA	2323	2503	2.61e-53	SMART
TSPN	2522	2714	1.13e-76	SMART
Pfam:Collagen	2747	2804	4.7e-9	PFAM
Pfam:Collagen	2802	2861	2.9e-9	PFAM
Pfam:Collagen	2838	2900	7.1e-8	PFAM
Pfam:Collagen	2935	2990	1.3e-8	PFAM
low complexity region	3007	3040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135009

SMART Domains

Protein: ENSMUSP00000123455
Gene: ENSMUSG00000032332

Domain	Start	End	E-Value	Type
Pfam:Collagen	1	56	6.1e-11	PFAM
Pfam:Collagen	40	98	1.4e-11	PFAM
Pfam:Collagen	133	188	9.2e-10	PFAM
low complexity region	205	238	N/A	INTRINSIC

Meta Mutation Damage Score

0.0689

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (124/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 122 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,268,314	M395V	probably benign	Het
2610507B11Rik	T	A	11: 78,268,749	C541*	probably null	Het
9130011E15Rik	C	T	19: 45,978,667	R12Q	probably damaging	Het
A4gnt	T	C	9: 99,620,359	S191P	probably damaging	Het
AI314180	G	T	4: 58,824,270	P1116T	probably damaging	Het
Ak2	C	T	4: 129,008,197	A221V	probably damaging	Het
Akap9	T	A	5: 3,961,010	V571E	probably damaging	Het
Amph	G	T	13: 19,125,035	E428*	probably null	Het
Arnt2	T	A	7: 84,343,870	D154V	probably damaging	Het
Arrdc1	G	A	2: 24,926,352	Q202*	probably null	Het
Ate1	A	G	7: 130,510,913	C72R	probably damaging	Het
Atox1	A	G	11: 55,454,898	V22A	possibly damaging	Het
Bbs12	A	T	3: 37,319,066	M3L	probably damaging	Het
BC067074	T	A	13: 113,318,094	W225R	probably damaging	Het
Bfsp1	A	G	2: 143,862,678	V85A	probably benign	Het
Caskin2	C	A	11: 115,803,630	V382F	probably benign	Het
Ccdc39	T	A	3: 33,819,896	M596L	probably damaging	Het
Cd22	C	T	7: 30,870,105	V529M	probably damaging	Het
Cd22	A	C	7: 30,876,156	Y154D	probably benign	Het
Cdadc1	T	A	14: 59,581,334	E348D	probably damaging	Het
Cdhr2	T	C	13: 54,720,818	V531A	probably damaging	Het
Cdk11b	A	G	4: 155,641,604		probably benign	Het
Cebpa	G	T	7: 35,119,522	R35L	probably damaging	Het
Chat	T	C	14: 32,446,873	N235S	probably benign	Het
Cracr2b	A	G	7: 141,465,280	E231G	probably damaging	Het
Cryaa	G	T	17: 31,681,055	A151S	probably benign	Het
Dab1	A	T	4: 104,678,741	I116F	probably damaging	Het
Ddx43	C	A	9: 78,396,104	N75K	probably benign	Het
Dmbt1	T	G	7: 131,099,133	C1014G	possibly damaging	Het
Dner	C	A	1: 84,405,989	C558F	probably damaging	Het
Dsc2	A	G	18: 20,032,399	V839A	possibly damaging	Het
Dsg3	C	T	18: 20,527,737	R378*	probably null	Het
Emilin1	C	T	5: 30,917,738	P441L	possibly damaging	Het
Epha6	T	C	16: 59,655,797	M1069V	probably damaging	Het
F930017D23Rik	A	C	10: 43,604,420		noncoding transcript	Het
Faf1	A	T	4: 109,710,808	N22Y	probably damaging	Het
Flrt3	A	T	2: 140,661,453	V85E	probably damaging	Het
Gadl1	T	A	9: 115,941,380	I87N	probably damaging	Het
Galnt14	A	G	17: 73,512,153	F314S	probably damaging	Het
Gba2	A	T	4: 43,574,029	Y141*	probably null	Het
Gdap1	A	T	1: 17,145,465		probably benign	Het
Gfod1	A	T	13: 43,303,243		probably null	Het
Gm14295	C	T	2: 176,810,681	R655*	probably null	Het
Gm4353	A	G	7: 116,083,699	S216P	probably damaging	Het
Gm6605	T	A	7: 38,448,282		noncoding transcript	Het
Hectd1	A	T	12: 51,794,444	D634E	probably damaging	Het
Helz2	A	G	2: 181,240,544	I152T	probably damaging	Het
Hivep1	A	G	13: 42,160,124	K1947E	possibly damaging	Het
Ifrd1	A	T	12: 40,213,245	F144L	probably benign	Het
Itgae	A	T	11: 73,118,622	Q544L	probably benign	Het
Jmjd1c	A	T	10: 67,218,426	E323D	probably damaging	Het
Kdm5a	G	T	6: 120,381,617	R207L	probably benign	Het
Kif5b	C	T	18: 6,226,377		probably null	Het
Lbp	T	C	2: 158,324,579	V351A	probably benign	Het
Lss	A	T	10: 76,546,098		probably null	Het
Madd	A	C	2: 91,161,486		probably benign	Het
Map6	G	A	7: 99,317,472	V503I	probably damaging	Het
Mark1	A	G	1: 184,928,063	L22P	probably damaging	Het
Mcfd2	T	C	17: 87,255,976	N130D	probably damaging	Het
Mcm3ap	A	G	10: 76,470,068	N5S	probably benign	Het
Mdm4	A	T	1: 133,012,651	F48I	probably damaging	Het
Mga	A	T	2: 119,964,980		probably benign	Het
Mknk2	A	T	10: 80,671,557		probably null	Het
Mmp15	T	C	8: 95,370,779	Y459H	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,288	K879R	probably benign	Het
Mycbp2	T	C	14: 103,287,260	K655E	probably damaging	Het
Nasp	T	C	4: 116,611,126	N221D	probably benign	Het
Ndc80	T	C	17: 71,514,218	E245G	probably benign	Het
Nmral1	C	T	16: 4,716,329	E83K	probably damaging	Het
Noa1	T	A	5: 77,304,187	Q550L	possibly damaging	Het
Nutm1	A	T	2: 112,255,752	Y211*	probably null	Het
Olfr1420	T	A	19: 11,896,557	Y179N	probably damaging	Het
Olfr1474	A	G	19: 13,471,241	I90M	probably damaging	Het
Olfr148	G	T	9: 39,613,775	M69I	probably benign	Het
Olfr700	A	C	7: 106,805,768	H231Q	probably benign	Het
Olfr723	T	C	14: 49,929,021	I174M	possibly damaging	Het
Otoa	T	C	7: 121,131,328	F584L	probably damaging	Het
Palb2	G	A	7: 122,124,525	T304I	possibly damaging	Het
Pcolce2	A	T	9: 95,670,176	M121L	probably benign	Het
Pcsk5	T	C	19: 17,454,872	T1460A	probably benign	Het
Pdzrn4	A	T	15: 92,770,160	D731V	probably damaging	Het
Pex11b	C	A	3: 96,635,721	Q12K	possibly damaging	Het
Pigw	G	C	11: 84,877,310	Q398E	probably benign	Het
Pkd1	A	G	17: 24,569,914	E882G	possibly damaging	Het
Pkhd1	A	T	1: 20,612,812	N55K	possibly damaging	Het
Plch2	A	T	4: 155,042,841		probably benign	Het
Plcl1	T	A	1: 55,751,345	L1058Q	probably benign	Het
Ppfia2	T	C	10: 106,837,329	S511P	possibly damaging	Het
Ppfibp2	T	C	7: 107,739,230	L676P	probably damaging	Het
Ppp6c	T	G	2: 39,226,174	D23A	probably damaging	Het
Pqlc1	G	T	18: 80,291,715	A232S	probably benign	Het
Prss30	G	A	17: 23,974,668		probably benign	Het
Ptprz1	T	C	6: 23,049,675		probably null	Het
Rec114	T	A	9: 58,652,905		probably benign	Het
Ryr2	T	C	13: 11,665,878		probably null	Het
Ryr3	A	T	2: 112,663,004	I3715N	possibly damaging	Het
Scin	T	C	12: 40,080,948	Y322C	probably damaging	Het
Scn3a	A	G	2: 65,461,308	V1698A	probably damaging	Het
Scn5a	G	A	9: 119,485,651	S1996L	probably damaging	Het
Serpinb2	A	G	1: 107,522,795	K174R	possibly damaging	Het
Slc16a4	T	C	3: 107,300,711	I179T	probably benign	Het
Slc35b1	T	G	11: 95,385,892	F102V	possibly damaging	Het
Slc6a15	A	G	10: 103,409,734	D526G	probably benign	Het
Spata16	A	G	3: 26,924,370	D495G	probably damaging	Het
Stk11ip	G	A	1: 75,529,584	E583K	possibly damaging	Het
Stk-ps1	T	G	17: 36,398,152		noncoding transcript	Het
Sufu	T	A	19: 46,397,212	I37N	probably damaging	Het
Tacr1	C	T	6: 82,492,554	P140S	probably damaging	Het
Tas1r3	G	A	4: 155,860,470	R765C	probably damaging	Het
Tenm3	C	T	8: 48,342,256		probably null	Het
Tex36	A	T	7: 133,595,223	I55N	probably damaging	Het
Tmem150c	T	C	5: 100,080,028	Y192C	probably damaging	Het
Tmem237	A	G	1: 59,120,286		probably benign	Het
Trim11	A	G	11: 58,982,063	E191G	probably damaging	Het
Ttll3	C	T	6: 113,409,042	A612V	possibly damaging	Het
Ttn	G	A	2: 76,977,122	A89V	probably damaging	Het
Usp37	A	G	1: 74,468,272	F529L	probably damaging	Het
Vmn1r217	A	C	13: 23,114,528	V68G	probably benign	Het
Vwf	T	C	6: 125,591,188	S349P	probably damaging	Het
Wt1	G	A	2: 105,131,157		probably null	Het
Zcchc7	T	A	4: 44,895,838	L262H	probably damaging	Het
Zfp873	A	G	10: 82,060,157	S241G	probably benign	Het

Other mutations in Col12a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Col12a1	APN	9	79681537	missense	possibly damaging	0.55
IGL00434:Col12a1	APN	9	79653332	missense	probably benign	0.27
IGL00465:Col12a1	APN	9	79697581	missense	probably damaging	1.00
IGL00568:Col12a1	APN	9	79651477	missense	probably damaging	1.00
IGL00576:Col12a1	APN	9	79647652	missense	probably damaging	1.00
IGL00580:Col12a1	APN	9	79692226	missense	probably benign	0.05
IGL01015:Col12a1	APN	9	79633741	missense	probably damaging	1.00
IGL01124:Col12a1	APN	9	79703847	missense	probably damaging	1.00
IGL01138:Col12a1	APN	9	79678053	missense	probably damaging	1.00
IGL01295:Col12a1	APN	9	79643926	missense	probably damaging	1.00
IGL01630:Col12a1	APN	9	79657366	missense	probably damaging	1.00
IGL01648:Col12a1	APN	9	79601169	makesense	probably null
IGL01878:Col12a1	APN	9	79649975	missense	possibly damaging	0.72
IGL01921:Col12a1	APN	9	79650017	missense	possibly damaging	0.50
IGL02064:Col12a1	APN	9	79692372	missense	probably benign	0.06
IGL02123:Col12a1	APN	9	79662458	critical splice donor site	probably null
IGL02312:Col12a1	APN	9	79681515	missense	probably damaging	1.00
IGL02320:Col12a1	APN	9	79616021	critical splice donor site	probably null
IGL02328:Col12a1	APN	9	79682066	missense	probably damaging	1.00
IGL02342:Col12a1	APN	9	79649896	splice site	probably null
IGL02355:Col12a1	APN	9	79630711	splice site	probably benign
IGL02362:Col12a1	APN	9	79630711	splice site	probably benign
IGL02396:Col12a1	APN	9	79662583	missense	probably benign
IGL02449:Col12a1	APN	9	79641469	missense	probably damaging	1.00
IGL02682:Col12a1	APN	9	79699341	missense	probably damaging	1.00
IGL02751:Col12a1	APN	9	79613859	unclassified	probably benign
IGL02801:Col12a1	APN	9	79608414	splice site	probably null
IGL03001:Col12a1	APN	9	79633673	missense	probably damaging	1.00
IGL03027:Col12a1	APN	9	79641551	missense	probably benign	0.40
IGL03090:Col12a1	APN	9	79678370	missense	probably damaging	1.00
IGL03115:Col12a1	APN	9	79681437	missense	probably damaging	1.00
IGL03220:Col12a1	APN	9	79699483	missense	probably damaging	1.00
IGL03240:Col12a1	APN	9	79678383	splice site	probably null
IGL03348:Col12a1	APN	9	79693430	missense	possibly damaging	0.88
airship	UTSW	9	79706337	missense	possibly damaging	0.65
dirigible	UTSW	9	79703829	missense	possibly damaging	0.73
Feast	UTSW	9	79700262	missense	probably benign	0.00
hardly	UTSW	9	79700350	nonsense	probably null
hearty	UTSW	9	79643966	missense	probably damaging	1.00
Hefty	UTSW	9	79662454	splice site	probably benign
P0045:Col12a1	UTSW	9	79647611	missense	probably damaging	0.99
PIT4260001:Col12a1	UTSW	9	79651380	critical splice donor site	probably null
PIT4280001:Col12a1	UTSW	9	79678105	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0015:Col12a1	UTSW	9	79651385	missense	probably damaging	1.00
R0240:Col12a1	UTSW	9	79652033	missense	probably benign	0.02
R0276:Col12a1	UTSW	9	79630741	nonsense	probably null
R0309:Col12a1	UTSW	9	79600011	splice site	probably null
R0336:Col12a1	UTSW	9	79702345	missense	probably damaging	0.98
R0376:Col12a1	UTSW	9	79693494	missense	probably benign	0.10
R0413:Col12a1	UTSW	9	79699360	missense	probably damaging	0.99
R0504:Col12a1	UTSW	9	79681468	missense	possibly damaging	0.90
R0542:Col12a1	UTSW	9	79605328	critical splice donor site	probably null
R0610:Col12a1	UTSW	9	79707848	missense	probably benign
R0631:Col12a1	UTSW	9	79703376	missense	probably damaging	1.00
R0637:Col12a1	UTSW	9	79656735	missense	probably benign	0.00
R0667:Col12a1	UTSW	9	79628462	missense	probably damaging	1.00
R0711:Col12a1	UTSW	9	79652035	missense	probably damaging	1.00
R0717:Col12a1	UTSW	9	79612419	missense	probably damaging	1.00
R0762:Col12a1	UTSW	9	79681374	splice site	probably benign
R0787:Col12a1	UTSW	9	79638485	missense	probably damaging	0.99
R0890:Col12a1	UTSW	9	79700402	missense	probably damaging	0.97
R0900:Col12a1	UTSW	9	79684253	missense	possibly damaging	0.91
R1109:Col12a1	UTSW	9	79699723	missense	probably damaging	1.00
R1264:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R1321:Col12a1	UTSW	9	79617709	nonsense	probably null
R1344:Col12a1	UTSW	9	79699555	nonsense	probably null
R1387:Col12a1	UTSW	9	79681375	splice site	probably benign
R1511:Col12a1	UTSW	9	79699552	missense	probably benign	0.02
R1523:Col12a1	UTSW	9	79660996	missense	probably benign	0.01
R1526:Col12a1	UTSW	9	79656798	missense	probably benign	0.44
R1564:Col12a1	UTSW	9	79613840	missense	probably damaging	1.00
R1595:Col12a1	UTSW	9	79602254	missense	probably damaging	1.00
R1603:Col12a1	UTSW	9	79612962	missense	probably damaging	1.00
R1673:Col12a1	UTSW	9	79693538	missense	probably benign	0.00
R1730:Col12a1	UTSW	9	79628378	missense	possibly damaging	0.93
R1737:Col12a1	UTSW	9	79703451	missense	probably damaging	1.00
R1739:Col12a1	UTSW	9	79633468	missense	probably damaging	0.98
R1748:Col12a1	UTSW	9	79672997	missense	probably benign	0.01
R1778:Col12a1	UTSW	9	79604585	splice site	probably benign
R1845:Col12a1	UTSW	9	79697541	missense	probably benign	0.09
R1864:Col12a1	UTSW	9	79627103	splice site	probably null
R1876:Col12a1	UTSW	9	79678281	nonsense	probably null
R1934:Col12a1	UTSW	9	79604522	nonsense	probably null
R1942:Col12a1	UTSW	9	79635466	missense	probably damaging	1.00
R1950:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R2027:Col12a1	UTSW	9	79645793	critical splice acceptor site	probably null
R2064:Col12a1	UTSW	9	79662454	splice site	probably benign
R2070:Col12a1	UTSW	9	79647696	missense	probably benign	0.00
R2112:Col12a1	UTSW	9	79643899	missense	possibly damaging	0.93
R2209:Col12a1	UTSW	9	79692352	missense	possibly damaging	0.83
R2275:Col12a1	UTSW	9	79635427	missense	probably damaging	0.99
R2330:Col12a1	UTSW	9	79633657	missense	probably damaging	0.99
R2373:Col12a1	UTSW	9	79656813	missense	probably benign	0.03
R2425:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R2428:Col12a1	UTSW	9	79602251	missense	probably benign	0.30
R2437:Col12a1	UTSW	9	79692219	missense	probably damaging	0.97
R2831:Col12a1	UTSW	9	79697401	missense	probably null	0.99
R2851:Col12a1	UTSW	9	79678332	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2872:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2874:Col12a1	UTSW	9	79699549	missense	probably damaging	1.00
R2904:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2905:Col12a1	UTSW	9	79652025	missense	probably damaging	1.00
R2991:Col12a1	UTSW	9	79700265	missense	probably damaging	1.00
R3402:Col12a1	UTSW	9	79643947	missense	probably damaging	1.00
R3429:Col12a1	UTSW	9	79680311	missense	probably benign
R3430:Col12a1	UTSW	9	79680311	missense	probably benign
R3547:Col12a1	UTSW	9	79633416	missense	probably damaging	1.00
R3789:Col12a1	UTSW	9	79639723	missense	possibly damaging	0.96
R4091:Col12a1	UTSW	9	79702364	missense	probably damaging	0.99
R4328:Col12a1	UTSW	9	79700389	missense	possibly damaging	0.91
R4382:Col12a1	UTSW	9	79630741	nonsense	probably null
R4392:Col12a1	UTSW	9	79662488	missense	probably damaging	1.00
R4405:Col12a1	UTSW	9	79639965	critical splice donor site	probably null
R4465:Col12a1	UTSW	9	79672910	missense	possibly damaging	0.62
R4521:Col12a1	UTSW	9	79633357	missense	probably benign	0.00
R4612:Col12a1	UTSW	9	79616057	missense	probably damaging	0.99
R4613:Col12a1	UTSW	9	79647601	missense	probably benign	0.03
R4649:Col12a1	UTSW	9	79639794	missense	probably damaging	1.00
R4651:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4652:Col12a1	UTSW	9	79612946	missense	probably damaging	1.00
R4738:Col12a1	UTSW	9	79699282	missense	probably damaging	1.00
R4745:Col12a1	UTSW	9	79652086	splice site	probably null
R4761:Col12a1	UTSW	9	79657310	missense	probably benign	0.34
R4784:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4785:Col12a1	UTSW	9	79678494	missense	possibly damaging	0.50
R4809:Col12a1	UTSW	9	79693567	missense	probably benign	0.10
R4821:Col12a1	UTSW	9	79715340	intron	probably benign
R4925:Col12a1	UTSW	9	79674795	missense	probably damaging	1.00
R4938:Col12a1	UTSW	9	79700350	nonsense	probably null
R5034:Col12a1	UTSW	9	79657367	missense	probably damaging	1.00
R5133:Col12a1	UTSW	9	79605174	missense	probably damaging	0.99
R5138:Col12a1	UTSW	9	79643966	missense	probably damaging	1.00
R5145:Col12a1	UTSW	9	79706300	missense	probably benign	0.00
R5152:Col12a1	UTSW	9	79656748	missense	probably damaging	1.00
R5237:Col12a1	UTSW	9	79700262	missense	probably benign	0.00
R5268:Col12a1	UTSW	9	79678047	missense	probably damaging	0.99
R5328:Col12a1	UTSW	9	79620060	missense	probably damaging	0.96
R5372:Col12a1	UTSW	9	79678366	missense	probably damaging	1.00
R5440:Col12a1	UTSW	9	79614363	missense	probably benign	0.07
R5496:Col12a1	UTSW	9	79602185	splice site	probably benign
R5537:Col12a1	UTSW	9	79699590	missense	probably damaging	1.00
R5596:Col12a1	UTSW	9	79703759	missense	probably damaging	1.00
R5677:Col12a1	UTSW	9	79699321	missense	probably damaging	1.00
R5715:Col12a1	UTSW	9	79616065	nonsense	probably null
R5796:Col12a1	UTSW	9	79703829	missense	possibly damaging	0.73
R5829:Col12a1	UTSW	9	79633673	missense	probably damaging	1.00
R5865:Col12a1	UTSW	9	79604478	missense	probably benign	0.00
R5919:Col12a1	UTSW	9	79602298	missense	probably damaging	0.99
R5974:Col12a1	UTSW	9	79682127	missense	probably damaging	0.99
R5981:Col12a1	UTSW	9	79678506	missense	probably damaging	0.99
R5982:Col12a1	UTSW	9	79630560	missense	probably damaging	1.00
R6027:Col12a1	UTSW	9	79656578	critical splice donor site	probably null
R6090:Col12a1	UTSW	9	79692393	missense	probably damaging	1.00
R6293:Col12a1	UTSW	9	79614358	missense	probably benign	0.00
R6393:Col12a1	UTSW	9	79655485	missense	probably damaging	0.99
R6457:Col12a1	UTSW	9	79645691	missense	probably damaging	1.00
R6505:Col12a1	UTSW	9	79647605	missense	probably damaging	0.98
R6508:Col12a1	UTSW	9	79649949	missense	probably damaging	1.00
R6620:Col12a1	UTSW	9	79620049	missense	probably damaging	0.98
R6718:Col12a1	UTSW	9	79699605	missense	probably damaging	1.00
R6752:Col12a1	UTSW	9	79633424	missense	possibly damaging	0.72
R6774:Col12a1	UTSW	9	79706337	missense	possibly damaging	0.65
R6872:Col12a1	UTSW	9	79677234	missense	probably damaging	1.00
R6884:Col12a1	UTSW	9	79639809	missense	possibly damaging	0.92
R6935:Col12a1	UTSW	9	79700500	missense	possibly damaging	0.76
R7198:Col12a1	UTSW	9	79650032	missense	possibly damaging	0.56
R7296:Col12a1	UTSW	9	79682066	missense	probably damaging	1.00
R7365:Col12a1	UTSW	9	79706360	missense	probably damaging	0.99
R7466:Col12a1	UTSW	9	79655407	missense	possibly damaging	0.95
R7516:Col12a1	UTSW	9	79612910	splice site	probably null
R7584:Col12a1	UTSW	9	79703296	critical splice donor site	probably null
R7624:Col12a1	UTSW	9	79645794	splice site	probably null
R7670:Col12a1	UTSW	9	79631643	missense	probably damaging	1.00
R7678:Col12a1	UTSW	9	79651486	missense	probably damaging	0.99
R7702:Col12a1	UTSW	9	79681521	missense	probably damaging	1.00
R7796:Col12a1	UTSW	9	79678551	missense	possibly damaging	0.88
R7902:Col12a1	UTSW	9	79641581	missense	probably benign	0.00
R7923:Col12a1	UTSW	9	79678493	missense	probably benign	0.00
R7986:Col12a1	UTSW	9	79604392	critical splice donor site	probably null
R8004:Col12a1	UTSW	9	79684401	missense	probably damaging	1.00
R8046:Col12a1	UTSW	9	79706226	critical splice donor site	probably null
R8056:Col12a1	UTSW	9	79599938	missense
R8151:Col12a1	UTSW	9	79630549	missense	possibly damaging	0.62
R8203:Col12a1	UTSW	9	79681549	missense	possibly damaging	0.94
R8221:Col12a1	UTSW	9	79643942	missense	probably damaging	1.00
R8294:Col12a1	UTSW	9	79699312	missense	possibly damaging	0.91
R8309:Col12a1	UTSW	9	79605183	missense	possibly damaging	0.68
R8319:Col12a1	UTSW	9	79648697	missense	probably damaging	0.97
R8351:Col12a1	UTSW	9	79681412	missense	probably damaging	0.97
R8442:Col12a1	UTSW	9	79635499	missense	probably damaging	1.00
R8500:Col12a1	UTSW	9	79609851	missense	probably damaging	1.00
R8682:Col12a1	UTSW	9	79661076	missense	probably benign	0.03
R8700:Col12a1	UTSW	9	79620089	missense	probably benign	0.09
R8859:Col12a1	UTSW	9	79680399	nonsense	probably null
R8898:Col12a1	UTSW	9	79692295	missense	probably benign	0.08
R8930:Col12a1	UTSW	9	79673383	missense	probably benign
R8932:Col12a1	UTSW	9	79673383	missense	probably benign
R8949:Col12a1	UTSW	9	79674688	missense	probably benign	0.17
R8962:Col12a1	UTSW	9	79631619	missense	probably damaging	1.00
R9045:Col12a1	UTSW	9	79674752	missense	probably benign	0.00
R9080:Col12a1	UTSW	9	79609851	missense	probably benign	0.06
R9145:Col12a1	UTSW	9	79620062	missense	probably benign	0.16
R9163:Col12a1	UTSW	9	79641447	critical splice donor site	probably null
R9168:Col12a1	UTSW	9	79641501	nonsense	probably null
R9188:Col12a1	UTSW	9	79602332	missense	probably benign	0.22
R9258:Col12a1	UTSW	9	79706363	missense	probably benign	0.04
R9292:Col12a1	UTSW	9	79678523	missense	probably benign	0.33
R9345:Col12a1	UTSW	9	79633735	missense	probably benign	0.08
R9382:Col12a1	UTSW	9	79682082	missense	probably benign	0.23
R9427:Col12a1	UTSW	9	79682163	missense	probably benign	0.15
R9601:Col12a1	UTSW	9	79617752	missense	probably damaging	0.98
R9653:Col12a1	UTSW	9	79677274	missense	probably benign
R9668:Col12a1	UTSW	9	79639678	nonsense	probably null
R9762:Col12a1	UTSW	9	79619984	missense	possibly damaging	0.82
X0021:Col12a1	UTSW	9	79608485	missense	probably damaging	1.00
X0058:Col12a1	UTSW	9	79602224	missense	possibly damaging	0.66
X0061:Col12a1	UTSW	9	79612392	splice site	probably null
Z1177:Col12a1	UTSW	9	79599986	missense	possibly damaging	0.80
Z1177:Col12a1	UTSW	9	79639696	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGCAAAAGGTCACGTGAGCC -3'
(R):5'- GAGAGACTCTACCTCAAATTGGTG -3'

Sequencing Primer
(F):5'- CCTGGCCTGAGCTGTGGTAAC -3'
(R):5'- CATTTTACACGCAAAAGGGAGTG -3'

Posted On

2015-05-15