Incidental Mutation 'R2061:Jmjd1c'
ID 316270
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Name jumonji domain containing 1C
Synonyms D630035I23Rik, TRIP8, 5430433L24Rik
MMRRC Submission 040066-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.662) question?
Stock # R2061 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 66932189-67092105 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 67054205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 323 (E323D)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
AlphaFold Q69ZK6
Predicted Effect possibly damaging
Transcript: ENSMUST00000051446
AA Change: E323D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: E323D

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173661
Predicted Effect possibly damaging
Transcript: ENSMUST00000173689
AA Change: E142D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: E142D

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174317
AA Change: E36D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876
AA Change: E36D

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174408
AA Change: E323D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: E323D

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (124/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,502,412 (GRCm39) S191P probably damaging Het
Ak2 C T 4: 128,901,990 (GRCm39) A221V probably damaging Het
Akap9 T A 5: 4,011,010 (GRCm39) V571E probably damaging Het
Amph G T 13: 19,309,205 (GRCm39) E428* probably null Het
Armh3 C T 19: 45,967,106 (GRCm39) R12Q probably damaging Het
Arnt2 T A 7: 83,993,078 (GRCm39) D154V probably damaging Het
Arrdc1 G A 2: 24,816,364 (GRCm39) Q202* probably null Het
Ate1 A G 7: 130,112,643 (GRCm39) C72R probably damaging Het
Atox1 A G 11: 55,345,724 (GRCm39) V22A possibly damaging Het
Bbs12 A T 3: 37,373,215 (GRCm39) M3L probably damaging Het
Bfsp1 A G 2: 143,704,598 (GRCm39) V85A probably benign Het
Bltp2 T A 11: 78,159,575 (GRCm39) C541* probably null Het
Caskin2 C A 11: 115,694,456 (GRCm39) V382F probably benign Het
Ccdc39 T A 3: 33,874,045 (GRCm39) M596L probably damaging Het
Cd22 C T 7: 30,569,530 (GRCm39) V529M probably damaging Het
Cd22 A C 7: 30,575,581 (GRCm39) Y154D probably benign Het
Cdadc1 T A 14: 59,818,783 (GRCm39) E348D probably damaging Het
Cdhr2 T C 13: 54,868,631 (GRCm39) V531A probably damaging Het
Cdk11b A G 4: 155,726,061 (GRCm39) probably benign Het
Cebpa G T 7: 34,818,947 (GRCm39) R35L probably damaging Het
Chat T C 14: 32,168,830 (GRCm39) N235S probably benign Het
Col12a1 T A 9: 79,524,987 (GRCm39) I2725F possibly damaging Het
Cracr2b A G 7: 141,045,193 (GRCm39) E231G probably damaging Het
Cryaa G T 17: 31,900,029 (GRCm39) A151S probably benign Het
Cspg4b T A 13: 113,454,628 (GRCm39) W225R probably damaging Het
Dab1 A T 4: 104,535,938 (GRCm39) I116F probably damaging Het
Ddx43 C A 9: 78,303,386 (GRCm39) N75K probably benign Het
Dmbt1 T G 7: 130,700,863 (GRCm39) C1014G possibly damaging Het
Dner C A 1: 84,383,710 (GRCm39) C558F probably damaging Het
Dsc2 A G 18: 20,165,456 (GRCm39) V839A possibly damaging Het
Dsg3 C T 18: 20,660,794 (GRCm39) R378* probably null Het
Ecpas G T 4: 58,824,270 (GRCm39) P1116T probably damaging Het
Emilin1 C T 5: 31,075,082 (GRCm39) P441L possibly damaging Het
Epha6 T C 16: 59,476,160 (GRCm39) M1069V probably damaging Het
F930017D23Rik A C 10: 43,480,416 (GRCm39) noncoding transcript Het
Faf1 A T 4: 109,568,005 (GRCm39) N22Y probably damaging Het
Flrt3 A T 2: 140,503,373 (GRCm39) V85E probably damaging Het
Gadl1 T A 9: 115,770,448 (GRCm39) I87N probably damaging Het
Galnt14 A G 17: 73,819,148 (GRCm39) F314S probably damaging Het
Gba2 A T 4: 43,574,029 (GRCm39) Y141* probably null Het
Gdap1 A T 1: 17,215,689 (GRCm39) probably benign Het
Gfod1 A T 13: 43,456,719 (GRCm39) probably null Het
Gm14295 C T 2: 176,502,474 (GRCm39) R655* probably null Het
Gm4353 A G 7: 115,682,934 (GRCm39) S216P probably damaging Het
Gm6605 T A 7: 38,147,706 (GRCm39) noncoding transcript Het
Hectd1 A T 12: 51,841,227 (GRCm39) D634E probably damaging Het
Helz2 A G 2: 180,882,337 (GRCm39) I152T probably damaging Het
Hivep1 A G 13: 42,313,600 (GRCm39) K1947E possibly damaging Het
Ifrd1 A T 12: 40,263,244 (GRCm39) F144L probably benign Het
Inhca T C 9: 103,145,513 (GRCm39) M395V probably benign Het
Itgae A T 11: 73,009,448 (GRCm39) Q544L probably benign Het
Kdm5a G T 6: 120,358,578 (GRCm39) R207L probably benign Het
Kif5b C T 18: 6,226,377 (GRCm39) probably null Het
Lbp T C 2: 158,166,499 (GRCm39) V351A probably benign Het
Lss A T 10: 76,381,932 (GRCm39) probably null Het
Madd A C 2: 90,991,831 (GRCm39) probably benign Het
Map6 G A 7: 98,966,679 (GRCm39) V503I probably damaging Het
Mark1 A G 1: 184,660,260 (GRCm39) L22P probably damaging Het
Mcfd2 T C 17: 87,563,404 (GRCm39) N130D probably damaging Het
Mcm3ap A G 10: 76,305,902 (GRCm39) N5S probably benign Het
Mdm4 A T 1: 132,940,389 (GRCm39) F48I probably damaging Het
Mga A T 2: 119,795,461 (GRCm39) probably benign Het
Mknk2 A T 10: 80,507,391 (GRCm39) probably null Het
Mmp15 T C 8: 96,097,407 (GRCm39) Y459H possibly damaging Het
Mthfd1l A G 10: 4,053,288 (GRCm39) K879R probably benign Het
Mycbp2 T C 14: 103,524,696 (GRCm39) K655E probably damaging Het
Nasp T C 4: 116,468,323 (GRCm39) N221D probably benign Het
Ndc80 T C 17: 71,821,213 (GRCm39) E245G probably benign Het
Nmral1 C T 16: 4,534,193 (GRCm39) E83K probably damaging Het
Noa1 T A 5: 77,452,034 (GRCm39) Q550L possibly damaging Het
Nutm1 A T 2: 112,086,097 (GRCm39) Y211* probably null Het
Or10n1 G T 9: 39,525,071 (GRCm39) M69I probably benign Het
Or10v1 T A 19: 11,873,921 (GRCm39) Y179N probably damaging Het
Or2ag18 A C 7: 106,404,975 (GRCm39) H231Q probably benign Het
Or4l1 T C 14: 50,166,478 (GRCm39) I174M possibly damaging Het
Or5b118 A G 19: 13,448,605 (GRCm39) I90M probably damaging Het
Otoa T C 7: 120,730,551 (GRCm39) F584L probably damaging Het
Palb2 G A 7: 121,723,748 (GRCm39) T304I possibly damaging Het
Pcolce2 A T 9: 95,552,229 (GRCm39) M121L probably benign Het
Pcsk5 T C 19: 17,432,236 (GRCm39) T1460A probably benign Het
Pdzrn4 A T 15: 92,668,041 (GRCm39) D731V probably damaging Het
Pex11b C A 3: 96,543,037 (GRCm39) Q12K possibly damaging Het
Pigw G C 11: 84,768,136 (GRCm39) Q398E probably benign Het
Pkd1 A G 17: 24,788,888 (GRCm39) E882G possibly damaging Het
Pkhd1 A T 1: 20,683,036 (GRCm39) N55K possibly damaging Het
Plch2 A T 4: 155,127,298 (GRCm39) probably benign Het
Plcl1 T A 1: 55,790,504 (GRCm39) L1058Q probably benign Het
Ppfia2 T C 10: 106,673,190 (GRCm39) S511P possibly damaging Het
Ppfibp2 T C 7: 107,338,437 (GRCm39) L676P probably damaging Het
Ppp6c T G 2: 39,116,186 (GRCm39) D23A probably damaging Het
Prss30 G A 17: 24,193,642 (GRCm39) probably benign Het
Ptprz1 T C 6: 23,049,674 (GRCm39) probably null Het
Rec114 T A 9: 58,560,188 (GRCm39) probably benign Het
Ryr2 T C 13: 11,680,764 (GRCm39) probably null Het
Ryr3 A T 2: 112,493,349 (GRCm39) I3715N possibly damaging Het
Scin T C 12: 40,130,947 (GRCm39) Y322C probably damaging Het
Scn3a A G 2: 65,291,652 (GRCm39) V1698A probably damaging Het
Scn5a G A 9: 119,314,717 (GRCm39) S1996L probably damaging Het
Serpinb2 A G 1: 107,450,525 (GRCm39) K174R possibly damaging Het
Slc16a4 T C 3: 107,208,027 (GRCm39) I179T probably benign Het
Slc35b1 T G 11: 95,276,718 (GRCm39) F102V possibly damaging Het
Slc66a2 G T 18: 80,334,930 (GRCm39) A232S probably benign Het
Slc6a15 A G 10: 103,245,595 (GRCm39) D526G probably benign Het
Spata16 A G 3: 26,978,519 (GRCm39) D495G probably damaging Het
Stk11ip G A 1: 75,506,228 (GRCm39) E583K possibly damaging Het
Stk-ps1 T G 17: 36,709,044 (GRCm39) noncoding transcript Het
Sufu T A 19: 46,385,651 (GRCm39) I37N probably damaging Het
Tacr1 C T 6: 82,469,535 (GRCm39) P140S probably damaging Het
Tas1r3 G A 4: 155,944,927 (GRCm39) R765C probably damaging Het
Tenm3 C T 8: 48,795,291 (GRCm39) probably null Het
Tex36 A T 7: 133,196,952 (GRCm39) I55N probably damaging Het
Tmem150c T C 5: 100,227,887 (GRCm39) Y192C probably damaging Het
Tmem237 A G 1: 59,159,445 (GRCm39) probably benign Het
Trim11 A G 11: 58,872,889 (GRCm39) E191G probably damaging Het
Ttll3 C T 6: 113,386,003 (GRCm39) A612V possibly damaging Het
Ttn G A 2: 76,807,466 (GRCm39) A89V probably damaging Het
Usp37 A G 1: 74,507,431 (GRCm39) F529L probably damaging Het
Vmn1r217 A C 13: 23,298,698 (GRCm39) V68G probably benign Het
Vwf T C 6: 125,568,151 (GRCm39) S349P probably damaging Het
Wt1 G A 2: 104,961,502 (GRCm39) probably null Het
Zcchc7 T A 4: 44,895,838 (GRCm39) L262H probably damaging Het
Zfp873 A G 10: 81,895,991 (GRCm39) S241G probably benign Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67,062,494 (GRCm39) missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67,085,541 (GRCm39) missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67,067,794 (GRCm39) missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67,055,305 (GRCm39) missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67,079,648 (GRCm39) missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67,056,171 (GRCm39) missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67,056,101 (GRCm39) missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67,062,161 (GRCm39) missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67,061,640 (GRCm39) missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67,061,115 (GRCm39) missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67,055,433 (GRCm39) missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67,061,277 (GRCm39) missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67,067,849 (GRCm39) missense probably damaging 0.99
Accordion UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67,065,692 (GRCm39) missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67,055,105 (GRCm39) missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67,076,587 (GRCm39) missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67,054,888 (GRCm39) missense unknown
R0396:Jmjd1c UTSW 10 67,055,302 (GRCm39) missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67,056,161 (GRCm39) missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67,091,261 (GRCm39) missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67,076,506 (GRCm39) missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67,061,534 (GRCm39) missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67,061,568 (GRCm39) missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67,062,588 (GRCm39) missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67,054,725 (GRCm39) splice site probably null
R0755:Jmjd1c UTSW 10 66,932,378 (GRCm39) intron probably benign
R1142:Jmjd1c UTSW 10 67,061,124 (GRCm39) missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67,075,015 (GRCm39) splice site probably benign
R1413:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67,055,654 (GRCm39) missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67,060,588 (GRCm39) missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67,061,469 (GRCm39) missense probably benign
R1950:Jmjd1c UTSW 10 67,075,701 (GRCm39) missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67,061,219 (GRCm39) missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 66,993,777 (GRCm39) nonsense probably null
R2202:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2203:Jmjd1c UTSW 10 67,075,242 (GRCm39) splice site probably null
R2256:Jmjd1c UTSW 10 67,061,073 (GRCm39) missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67,074,629 (GRCm39) missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67,091,279 (GRCm39) missense probably benign
R2392:Jmjd1c UTSW 10 67,065,683 (GRCm39) missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 66,993,711 (GRCm39) missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67,075,863 (GRCm39) splice site probably benign
R4043:Jmjd1c UTSW 10 67,055,245 (GRCm39) missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67,054,787 (GRCm39) missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67,055,532 (GRCm39) missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 66,932,460 (GRCm39) intron probably benign
R4352:Jmjd1c UTSW 10 67,080,588 (GRCm39) missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67,085,529 (GRCm39) missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 66,993,753 (GRCm39) nonsense probably null
R4717:Jmjd1c UTSW 10 66,993,830 (GRCm39) nonsense probably null
R4741:Jmjd1c UTSW 10 67,060,718 (GRCm39) missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67,060,571 (GRCm39) missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67,069,225 (GRCm39) missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67,054,750 (GRCm39) missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67,081,916 (GRCm39) missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67,067,795 (GRCm39) missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67,076,480 (GRCm39) missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67,053,928 (GRCm39) missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67,085,541 (GRCm39) missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67,069,193 (GRCm39) missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67,061,857 (GRCm39) missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67,065,785 (GRCm39) missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67,056,112 (GRCm39) missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67,062,291 (GRCm39) missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67,075,791 (GRCm39) missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67,083,827 (GRCm39) missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67,056,187 (GRCm39) missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67,085,439 (GRCm39) missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67,061,718 (GRCm39) missense probably benign
R6430:Jmjd1c UTSW 10 67,059,939 (GRCm39) missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67,061,795 (GRCm39) missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67,025,599 (GRCm39) missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67,052,869 (GRCm39) missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67,056,388 (GRCm39) missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67,055,411 (GRCm39) missense probably benign 0.39
R7113:Jmjd1c UTSW 10 66,993,780 (GRCm39) missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67,061,844 (GRCm39) missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67,025,596 (GRCm39) missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67,054,143 (GRCm39) missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67,025,537 (GRCm39) missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67,052,815 (GRCm39) missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67,061,092 (GRCm39) missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67,067,794 (GRCm39) missense probably damaging 0.99
R7699:Jmjd1c UTSW 10 67,054,195 (GRCm39) missense probably benign 0.10
R7745:Jmjd1c UTSW 10 67,052,824 (GRCm39) missense probably damaging 0.96
R7897:Jmjd1c UTSW 10 67,075,644 (GRCm39) missense probably damaging 0.96
R7908:Jmjd1c UTSW 10 67,061,621 (GRCm39) missense probably benign
R7911:Jmjd1c UTSW 10 67,067,774 (GRCm39) missense probably damaging 1.00
R7967:Jmjd1c UTSW 10 67,085,461 (GRCm39) missense probably damaging 1.00
R8058:Jmjd1c UTSW 10 67,090,274 (GRCm39) missense not run
R8224:Jmjd1c UTSW 10 67,080,628 (GRCm39) missense noncoding transcript
R8251:Jmjd1c UTSW 10 67,075,068 (GRCm39) missense noncoding transcript
R8797:Jmjd1c UTSW 10 67,060,616 (GRCm39) missense probably benign
R8833:Jmjd1c UTSW 10 67,054,162 (GRCm39) missense probably benign 0.03
R9262:Jmjd1c UTSW 10 67,083,793 (GRCm39) missense probably benign 0.39
R9354:Jmjd1c UTSW 10 67,059,875 (GRCm39) missense probably damaging 0.99
R9373:Jmjd1c UTSW 10 66,932,495 (GRCm39) intron probably benign
R9477:Jmjd1c UTSW 10 66,993,734 (GRCm39) nonsense probably null
R9519:Jmjd1c UTSW 10 66,993,798 (GRCm39) missense possibly damaging 0.80
R9701:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
R9802:Jmjd1c UTSW 10 67,060,745 (GRCm39) missense possibly damaging 0.94
RF011:Jmjd1c UTSW 10 67,055,978 (GRCm39) missense possibly damaging 0.47
Z1088:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1176:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Z1177:Jmjd1c UTSW 10 67,081,904 (GRCm39) missense probably damaging 0.98
Z1177:Jmjd1c UTSW 10 67,073,953 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCACTGTTCACGTATGTATG -3'
(R):5'- GTCACCACGTGCTTGTTCTT -3'

Sequencing Primer
(F):5'- GCTCAAGCAAATAGTCCC -3'
(R):5'- GATCTCTGAGTCTGACACTAGCCAG -3'
Posted On 2015-05-15